Search for


TEXT SIZE

search for



CrossRef (0)
Development and Evaluation of a SYBR Green-Based, Real-time Polymerase Chain Reaction for Rapid and Specific Detection of Human Coxsackievirus B5
Biomed Sci Letters 2020;26:302-309
Published online December 31, 2020;  https://doi.org/10.15616/BSL.2020.26.4.302
© 2020 The Korean Society For Biomedical Laboratory Sciences.

Kyu Bong Cho†,*

Department of Biomedical Laboratory Science, Shinhan University, Uijeongbu 11644, Korea
Correspondence to: Kyu Bong Cho. Department of Biomedical Laboratory Science, Shinhan University, Uijeongbu 11644, Korea.
Tel: +82-31-870-3712, Fax: +82-31-870-3719, e-mail: kbcho@shinhan.ac.kr
*Professor.
Received October 15, 2020; Revised November 27, 2020; Accepted November 30, 2020.
 Abstract
Human Coxsackievirus B5 (HuCoxV-B5) infection has been associated with various diseases such as myocarditis, aseptic meningitis, hand-foot-and mouth-disease, and insulin-dependent diabetes. HuCoxV-B5 is a virus transmitted through the fecal-oral route and is detected in clinics, aquatic environments, food, shellfish, etc. and is one of the more important viruses in public health because of its incidence rate reported worldwide. In this study, a combination of SYBR Green-based real-time PCR primers for molecular diagnosis including monitoring of HuCoxV-B5 was selected and the optimal reaction conditions were established. Compared with the previously reported TaqMan probe-based real-time PCR method, assessments including a sample applicability test were performed. Results showed that the real-time PCR method developed in this study was suitable for a molecular diagnostic technique for detecting HuCoxV-B5. This study is expected to contribute to efforts in responding to safety accidents in public health because the proposed method facilitates rapid diagnosis of clinical patients. It can also be used as a specific monitoring tool of HuCoxV-B5 in non-clinical areas such as aquatic environments among others.
Keywords : Human Coxsackievirus B5, HuCoxV-B5, Real-time PCR, SYBR green
서 론

Human Coxsackievirus (HuCoxV)는 Poliovirus, Parechovirus 등과 함께 주요 Enterovirus 그룹에 포함되며, 한국, 미국, 중국, 이탈리아 등 선진국을 포함하여 전 세계적으로 빈번하게 보고되고 있어 공중 보건학적으로 중요한 바이러스 중 하나로 꼽힌다(Wagenknecht et al., 1991; Chen et al., 2012; Hyeon et al., 2013; Fontana et al., 2019). HuCoxV에 포함된 A와 B 중 B 그룹은 감염 시 일반적으로 무증상이지만, 수막염, 뇌염, 심근염, 경련성 마비, 발진, 호흡기 질환 등의 사례가 보고되었다(Zhang et al., 1993; Triantafyllopoulou et al., 2004; Papa et al., 2006; Gullberg et al., 2010; Hu et al., 2012). 이 중에서도 B5형(HuCoxV-B5)은 사람에게 가장 우세하게 나타나는 혈청형으로 바이러스성 심근염의 일반적 원인, 산발적으로 발병하는 확장성 심근 병증의 약 25% 이상의 원인, 무균성 수막염, 신경적 수족구병, 인슐린 의존성 당뇨병 등 다양한 질병과의 연관성이 보고되고 있다(Papa et al., 2006; Gullberg et al., 2010; Hu et al., 2012). HuCoxV-B5 등 Enterovirus 그룹에 포함되는 바이러스들은 분변-구강 경로로 전염 또는 오염되는 대표적인 장 관계 바이러스이며, 임상 외 수계 환경, 식품, 패류 등에서도 검출되므로 다양한 매질에서의 모니터링은 공중 보건학적으로 중요하다(Cho, 2018; Lee and Cho, 2019). 그러나 Enterovirus 그룹에 포함되는 바이러스들은 약 70종류 이상의 혈청형으로 구성된다(Oberste et al., 1999). 이들은 대부분 사람과 관련된 병원성 바이러스이며, 보고된 Enterovirus 혈청형들의 짧은 유전자 단편들의 복잡한 유연관계 등으로 특정 한 종류의 검출보다는 pan-enterovirus 등 Enterovirus 그룹을 전체적으로 모니터링 할 수 있는 항원-항체 및 분자적 기술이 연구되어 왔다(Lee and Jeong, 2004; Choi et al., 2013). 그러나 각 혈청형 별 다르게 나타나는 질병, 유행, 거동 특성 등으로 개별적 모니터링의 필요성이 제기되었으며, 71형 및 68형 Enterovirus 등을 중심으로 개별적 진단 기법들이 보고되었다(Tan et al., 2008). HuCoxV-B5 검출을 위해 항원-항체 기반의 enzyme-linked immunosorbent assay (ELISA)법이 사용되었으나(Kopecka et al., 1995), ELISA 기법은 위 양성, 검출 민감도, 객관적 판독 등의 문제점으로 인하여 최근에는 분자진단 기법들이 보고되고 있다(Lee et al., 2013). Jaianand et al. (2011), Zhao et al. (2013)에 의해 HuCoxV-B5 검출용 등온증폭법[loop-mediated isothermal amplification (LAMP)]이 보고되었으나, LAMP는 알 수 없는 비 특이적 증폭으로 인한 위 양성 반응, 상대적으로 고가의 비용, 좁은 범위의 사용자 등의 문제점이 보고된 바 있다(Hardinge and Murray, 2019; Schneider et al., 2019). Rezig et al. (2004) 등에 의해 일반 PCR 방법이 보고되었으나, 미량 오염 및 다수의 PCR 저해 물질이 포함된 환경 시료에서 요구되는 높은 특이성과 우수한 검출 민감도 문제를 해결하기 위해서는 PCR 증폭 후 증폭 산물을 주형으로 다시 한 번 증폭하는 nested PCR의 활용, PCR 저해 물질을 감소시키는 reagent의 사용 등으로 해결해야 하며, 상대적으로 복잡한 검사 과정, 전기영동 등으로 약 10시간 이상이 소요되는 한계점이 있었다(Lee et al., 2015; Lee et al., 2017). 한편 real-time PCR은 단일 과정으로 상대적으로 간편하고, 2시간 이내의 빠른 검출이 가능하며, nested PCR과 동등 이상 수준의 검출 민감도를 가진 기법으로 최근 임상과 비 임상에서 주요 분자진단 기법으로 활용되고 있다(Chen et al., 2017; Yoo et al., 2017; Corman et al., 2020). Mohamed et al. (2004)Kang et al. (2013)에 의해 VP1 일부 유전자 단편을 증폭하는 real-time PCR 방법이 보고되었으나, 특이성, 검출 민감도, 시료 적용성 평가 등의 연구는 미흡하다.

따라서 이번 연구에서는 HuCoxV-B5를 신속 및 특이적으로 검출할 수 있는 real-time PCR 방법을 개발하였으며, 환경 시료 등에서의 활용성을 평가하였다.

재료 및 방법

프라이머 설계 및 바이러스 핵산 수집

HuCoxV-B5 특이적 검출을 위한 프라이머 조합은 Mohamed et al. (2004)를 구성 예정인 PCR 조성물과 조건에 맞추어 변형 및 재설계 하였으며 (Table 1 and Fig. 1), Oligo Calculator version 3.27로 잠재적 hairpin 형성, self annealing 등을 검정하였다. 한편, HuCoxV-B5 5'-UTR 부분을 대상으로 핵산 단편을 증폭하는 검사법을 고안하기 위하여 National Center for Biotechnology Information (NCBI) accession number JX843811 기준 449-609 nucleotide (nt) (161 nt)를 마크로젠(Seoul, Korea)에 의뢰하여 단일 가닥으로 합성 및 유관 기관에서 HuCoxV-B5 cDNA를 수집하였다. 또한 비 특이적 반응에 사용할 참고 바이러스 15종[Adenovirus 41 (AdV-41), Aichivirus A (AiV-A), Aichivirus B (AiV-B), Aichivirus C (AiV-C), Astrovirus (AstV), Enterovirus 71 (EV-71), Enterovirus 68 (EV-68), Hepatitisvirus A (HAV), Hepatitisvirus E (HEV), Norovirus GI (NoV-GI), Norovirus GII (NoV-GII), Orthoreovirus segment S (OrV-S), Parachovirus A (PeV-A), Poliovirus type 3 (PV-type3) 및 Sapovirus (SaV)]의 핵산 염기서열 일부를 단일 가닥의 plasmid로 합성하였다.

Specific PCR primer sets for the detection of HuCoxV-B5

Set # Primer name Sequence (5'-3') Mer (nt) Location Product size (nt) Reference

Start Stop
1 CoxV-B5_F452 CCGGCCCCTGAATGCGGCTA 20 452 471 149 -
CoxV-B5_R600 TGTCACCATAAGCAGCCAGTGTAGG 25 576 600
2 CoxV-B5_F452 CCGGCCCCTGAATGCGGCTA 20 452 471 153 -
CoxV-B5_R604 CAATTGTCACCATAAGCAGCCAG 23 582 604
3 CoxV-B5_F454 GGCCCCTGAATGCGGCTA 18 454 471 147 -
CoxV-B5_R600 TGTCACCATAAGCAGCCAGTGTAGG 25 576 600
4 CoxV-B5_F454 GGCCCCTGAATGCGGCTA 18 454 471 151 -
CoxV-B5_R604 CAATTGTCACCATAAGCAGCCAG 23 582 604

Ref. #1 NMF1 GCCCCTGAATGCGGC 15 455 469 149 Mohamed et al., 2004
NMR1 AATTGTCACCATAAGCAGC 19 585 603
TaqMan® probe HEX-CGGAACCGACTACTTTGGGTGTCCGT-BHQ1 26 537 562
Ref. #2 CVB F AAACCCAAACATGTGAAGGCGTGG 24 3,166 3,189 118 Kang et al., 2013
CVB R TGGTAATGTTTGAGCGCGTTGTGG 24 3,260 3,283
CVB P HEX-ACCGCCGAGGCTATGTCAATATGAGA-BHQ1 26 3,198 3,223

Fig. 1. SYBR Green-based, real-time PCR primer map for the detection of Human Coxsackievirus B5 (HuCoxV-B5).

프라이머 선발

HuCoxV-B5에 특이적 반응이 추정되는 4개의 후보 프라이머 조합의 특이적 반응 및 검출 민감도를 분석하였다. HuCoxV-B5 plasmid 1 ng/μL 기준으로 10-6 (1 fg/μL)까지 10배 단계 희석하였으며, cDNA는 1,000, 500, 250, 100, 50, 10 copies 및 1 copy로 희석하였다. HuCoxV-B5 plasmid와 cDNA를 희석액을 주형으로 SYBR Green 기반의 real-time PCR을 수행하였으며, 조성은 iTaqTM Universal SYBR® Green Supermix (Biorad, USA) 10 μL, 정 방향 및 역 방향 프라이머 2 μL (25 pmol 1 μL, each), 주형 핵산 1 μL 및 nucleic acid free water 7 μL로 총 20 μL로 하였다. Real-time PCR 조건은 95℃에서 5분간 1회 초기 변성 후, 95℃에서 15초, 61℃에서 60초를 35회 반복하였다. 또한 특이적 반응 및 검출 민감도에서 우수한 결과를 보인 프라이머 조합을 대상으로 비 특이적 반응을 수행하였다. 주형 핵산으로 positive control [HuCoxV plasmid (100 pg/μL)], negative control [nucleic acid free water], 참고 바이러스 15종 핵산(AdV-41, AiV-A, AiV-B, AiV-C, AstV, EV-71, EV-68, HAV, HEV, NoV-GI, NoV-GII, OrV-S, PeV-A, PV-type 3 및 SaV)을 주형으로 반응하였다. 반응 조성 및 조건은 특이적 반응과 동일하게 하였다.

선발 프라이머의 평가

선발한 real-time PCR 프라이머의 평가를 위하여 기존 보고된 HuCoxV-B5 검출용 real-time PCR 방법과 검출 민감도 및 특이성을 비교하였다(Table 1). Real-time PCR 조성은 cDNA를 주형으로 사용 및 개발 프라이머 조건과 동일하게 하였으며, 조건은 각각의 보고된 방법과 동일하게 하였다(Mohamed et al., 2004; Kang et al., 2013). 또한 시료 적용성 시험을 위하여 환경부 국립환경과학원 2007-2016 관련 모니터링 자료(Lee et al., 2018)를 바탕으로 오염이 예상되는 지역 중 10개 지점의 지하수 시료를 무작위 채취하였으며, 실험실로 이동 후 탈리 및 농축을 수행하였다. 농축 시료에서 QIAamp® Viral RNA Mini (Qiagen, Germany)로 total RNA를 추출 후, ReverTra Ace-α-TM (Toyobo, Japan)을 사용하여 cDNA로 합성하였으며, 모두 제품의 매뉴얼에 따라 수행하였다. 시료 채취에서 핵산 추출까지의 과정은 환경부 국립환경과학원 고시 제 2017-50호에 의거하여 수행하였다. 선발된 real-time PCR 프라이머 조합을 사용하여 지하수 시료의 cDNA로부터 HuCoxV-B5를 검출하였다. 또한 선발한 프라이머 조합을 일반 PCR로 변형[95℃에서 5분간 1회 초기 변성, 35회 반복(95℃에서 45초, 61℃에서 60초 및 72℃에서 60초), 72℃에서 5분간 최종 신장]하여 HuCoxV-B5를 검출하였다. 또한 일반 PCR의 검출 민감도가 real-time PCR 보다 낮은 것은 감안하여 HuCoxV-B5_F452과 HuCoxV-B5_R604 프라이머를 이용 1차 PCR 증폭 후, 증폭 산물에서 선발 프라이머를 사용하여 nested PCR을 수행하였다. 환경 시료에서 PCR 및 nested PCR 시 조성물로 모두 비 특이적 밴드 억제 물질인 SL® Nonspecific reaction inhibitor (NSRI; LSLK, Korea)를 3 μL를 포함하여 반응하였다. 한편 nested PCR 증폭 산물들을 MEGAquick-spinTM Plus Total Fragment DNA Purification Kit (INtRON, Korea)를 사용하여 정제 후 마크로젠(https://dna.macrogen.com/main.do)에서 염기서열 분석하였으며, NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi)로 유사성을 확인하였다.

결과 및 고찰

총 4개의 후보 프라이머 조합은 모두 HuCoxV-B5 plasmid와 cDNA에서 특이적 반응이 나타났으며, plasmid 1~ 100 pg/μL, cDNA 250~1,000 copies의 검출 민감도가 나타났다. 이 중 후보 프라이머 조합 #2가 plasmid 1 pg/μL, cDNA 250 copies로 가장 우수한 검출 민감도를 보였으며, 조합 #3과 조합 #4는 조합 #2에 비해 plasmid 기준 약 10배, cDNA 기준 약 2배 수준 낮은 검출 민감도를 보였다. 한편 조합 #1은 plasmid 기준 #3과 #4와 동등 수준을 보였으나 cDNA에서 상대적으로 낮은 수준의 검출 민감도가 나타났다. 한편, single threshold 자동계산 방식을 기준으로 한 cycle quantification value (Cq) 값은 plasmid 100 pg/μL 기준 약 28.05~28.09, 10 pg/μL 기준 약 30.89~31.20 수준으로 나타났으며 cDNA 1,000 copies 기준 약 26.10~31.17, 500 copies 기준 27.72~32.93 수준으로 나타났다(Fig. 2). HuCoxV-B5 plasmid와 cDNA에서 Cq 값을 포함한 검출 민감도 등을 고려하여 조합 #2, #3 및 #4를 선발하였다. 또한 선발한 3개의 후보 프라이머 조합들을 대상으로 참고 바이러스 15종의 핵산에 비 특이적 반응을 분석한 결과, 조합 #2에서 4종(SaV, HAV, PV 및 EV-71)이 반응하였으며 Cq 값은 24.06~32.14 수준이었다. 조합 #4에서는 7종[AiV (A, B 및 C), AstV, EV-71, EV-68 및 HAV]이 반응하였으며, Cq 값은 29.44~32.01로 나타났다. 반면 조합 #3에서는 참고 바이러스 핵산으로부터 비 특이적 반응이 나타나지 않아 HuCoxV-B5를 특이적으로 증폭할 수 있는 프라이머 조합으로 추정하였으며 최종 선발하였다(Fig. 3).

Fig. 2. Specific reaction and sensitivity of four real-time PCR primer sets based on HuCoxV-B5 plasmid and cDNA.
Fig. 3. Non-specific reaction of three real-time PCR primer sets based on fifteen reference virus genes.

기존 보고된 HuCoxV-B5 검출용 real-time PCR Ref.#1과 #2는 비 특이적 반응이 나타나지 않았으며, cDNA 기준 약 500 copies까지 검출 민감도가 나타났으나, 선발 프라이머가 cDNA 500 copies 주형에서 1,000 relative fluorescence units (RFU) 이상이 분석된 반면 ref.#1과 #2는 RFU 값이 약 87.7~105.0 수준으로 낮게 나타나(Data not shown), 선발 프라이머가 포함된 조성물로 반응한 조건에 비해 상대적으로 낮은 검출 민감도가 추정되었다. 또한 선발한 프라이머 조합 #3으로 수계 환경 시료 10개에서 추출한 total RNA (12.3~74.4 ng/μL)에서 HuCoxV-B5를 검출한 결과, single threshold 1,000 RFU를 기준으로 10개 중 8개 시료에서 양성이 추정되었으며, Cq 값은 약 31.04~33.45 수준이었다(Fig. 4A). 선발한 프라이머 조합의 일반 PCR 변형 후 지하수 시료에서 HuCoxV-B5를 검출한 결과 모두 음성으로 나타났다(Fig. 4B). 또한 HuCoxV-B5_F452과 HuCoxV-B5_R604 프라이머를 이용 1차 증폭에서도 시료 10개 모두 음성, 1차 증폭 산물과 선발 프라이머 조합을 이용하여 nested PCR을 수행한 결과 1차 PCR에서 10개 시료에서 모두 음성이 확인되었고 nested PCR 결과 3개에서 양성 추정 밴드가 나타났다(Fig. 4B). Nested PCR로 증폭된 추정 밴드의 염기서열 분석 결과 #5는 비 특이적 반응, #8과 #10은 HuCoxV-B5로 최종 분석되어 10개 중 2개에서 HuCoxV-B5 양성으로 나타났다(Data not shown). PCR과 nested PCR로 반응한 일반 PCR에서는 비 특이적 반응을 억제하는 물질을 사용했음에도 불구하고 비 특이적 증폭이 다수 나타났으며, 이러한 문제점은 일반 nested PCR을 이용하여 시료를 검정하는 Lee et al. (2013) 등 다른 유관 연구들에서 나타나는 결과들과 유사하다. 이러한 문제점을 개선하기 위해서는 비 특이적 반응을 억제하는 물질의 고농도 사용, 물질의 변화 등 PCR 조성 및 조건을 설정, 염기서열 분석 전 추정 밴드의 gel-purification 등 일반 PCR 이 후 후속 노력이 필요한 과정을 포함한다.

Fig. 4. Evaluation of developed method using the groundwater samples. Panel A. Demonstration test using ten groundwater samples. Panel B. Comparative evaluation of developed method and conventional PCRs. M, 100 bp DNA Ladder maker (Enzynomics, Korea); P, positive control; N, negative control 1~10, sample number.

본 연구에서 개발한 HuCoxV-B5 검출용 프라이머 조합, 조성물 및 조건은 특이적으로 HuCoxV-B5를 검출할 수 있을 것으로 보인다. 기존 보고된 real-time PCR 방법 중 약 68분이던 ref.#1 (Mohamed et al., 2004)의 반응을 약 20분 단축하였으며, 해당 방법에 비해 상대적으로 우수한 검출 민감도를 보였다. 기존 보고된 real-time PCR 방법들은 모두 TaqMan probe 기반의 검사법으로 1개의 프로브 프라이머를 추가로 사용함으로써 SYBR green 기반의 real-time PCR보다 특이성 향상이 예상되었지만 이번 연구에서는 확인할 수 없었다. 그러나 프로브 프라이머의 사용으로 특수 케미컬이 추가되면 SYBR green 기반의 real-time PCR 또는 일반 PCR에서 사용되는 프라이머 조합 대비 약 25배의 프라이머 조합 단가 차이가 나는 등 고가이며, raw material 단가 향상으로 인해 이것은 향후 KIT 개발 시에도 영향을 미칠 것으로 보인다. 또한 선발 프라이머를 이용한 일반 PCR 방법들(1단계 PCR 및 nested PCR)에 비해 이번 연구에서 개발한 real-time PCR은 1단계 PCR에 비해서는 약 1시간, nested PCR에 비해서는 약 4시간 수준을 단축할 수 있었으며, 시료 적용 평가에서 상대적 우수한 결과가 분석되었다. 한편, 지하수 등 수계 환경 시료는 임상, 식품, 패류 등의 시료에 비해 대량의 매질 내 미량의 바이러스 오염 및 다수의 PCR 저해 물질이 존재한다(Cho, 2018; Lee and Cho, 2019). 분변-구강 경로로 감염되는 HuCoxV-B5의 경우 지하수 중 검출이 가능하다면 다른 매질로의 활용성이 가능할 것으로 보인다. 이번 연구에서는 10개 중 8개의 지하수 시료에서 HuCoxV-B5 양성이 나타났으며 일반 PCR 검사법 대비 특이성, 반응의 강도 등에서 우수한 결과가 분석되었다(Fig. 4). 따라서 이번 연구에서 개발한 방법은 향후 HuCoxV-B5 관련 증상이 나타나는 임상 환자에서 신속한 분자진단으로 후속 처방에 기여, 수계 환경, 식품, 패류 등 비 임상에서도 HuCoxV-B5 모니터링으로 활용되어 공중 보건학적 안전성 등 관련 사고 대응에 기여할 수 있을 것으로 기대된다.

ACKNOWLEDGEMENT

This work was supported by the Shihan University Research Fund, 2020.

CONFLICT OF INTEREST

The authors have declared no conflict of interest.

References
  1. Chen J, Zhang R, Ou X, Yao D, Huang Z, Li L, Sun B. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay. Mol Cellular Probes. 2017. 33: 8010.
    Pubmed CrossRef
  2. Chen P, Tao Z, Song Y, Liu G, Wang H, Liu Y, Xu A. A Coxsackievirus B5-associated aseptic meningitis outbreak in Shandong Province, China in 2009. J Med Virol. 2012. 85: 483-489.
    Pubmed CrossRef
  3. Cho KB. Development of Nested PCR Primer Set for the Specific and Highly Sensitive Detection of Human Parvovirus B19. Biomed Sci Lett. 2018. 24: 390-397.
    CrossRef
  4. Choi S, Jeong JE, Yun NN, Kim NH, Park YK, Jung EY. Study of the detection of enteric viruses and bacteria in spring-water and groundwater in Busan ('10~'11). J Bacteriol Virol. 2013. 43: 131-139.
    CrossRef
  5. Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, Bleicker T, Brünink S, Schneider J, Schmidt ML, Mulders DG, Haagmans BL, van der Veer B, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M, Peiris M, Goossens H, Reusken C, Koopmans MP, Drosten C. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 2020. 25: 2000045.
    Pubmed KoreaMed CrossRef
  6. Fontana S, Fiore S, Buttinelli G, Amato C, Veronesi L, Zoni R, Triassi M, Pennino F, Giammanco GM, De Grazia S, Cicala A, Siragusa A, Gamper S, Spertini S, Castiglia P, Cossu A, Germinario C, Larocca AMV, Stefanelli P. Molecular Characterization of Coxsackievirus B5 Isolates from Sewage, Italy 2016-2017. Food Environ Virol. 2019. 11: 440-445.
    Pubmed KoreaMed CrossRef
  7. Gullberg M, Tolf C, Jonsson N, Mulders MN, SK C, Hovi T, Lindberg AM. Characterization of a putative ancestor of Coxsackievirus B5. J Virol. 2010. 84: 9695-9708.
    Pubmed KoreaMed CrossRef
  8. Hardinge P, Murray J. Reduced false positives and improved reporting of loop-mediated isothermal amplification using quenched fluorescent primers. Sci Rep. 2019. 9: 3-13.
    Pubmed KoreaMed CrossRef
  9. Hu YF, Yang F, Du J, Zhang T, Xue Y, Jin Q. Coxsackievirus B5, associated with neurological hand, foot and mouth disease, China. J Infection. 2012. 65: 189-191.
    Pubmed CrossRef
  10. Hyeon JY, Hwang S, Kim H, Song J, Ahn J, Kang B, Kim K, Choi W, Chung JK, Kim CH, Cho K, Jee Y, Kim J, Kim K, Kim SH, Kim MJ, Cheon DS. Accuracy of diagnostic methods and surveillance sensitivity for human enterovirus, South Korea, 1999-2011. Emerg Infect Dis. 2013. 19: 1268-1275.
    Pubmed KoreaMed CrossRef
  11. Jaianand K, Saravanan N, Gunasekaran P, Sheriff A. Development of a new method for diagnosis of Group B Coxsackie genome by reverse transcription loop-mediated isothermal amplification. Indian J Med Microbiol. 2011. 29: 110-117.
    Pubmed CrossRef
  12. Kang LH, Oh S, Park JW, Won YJ, Ryu S, Paik SY. Simultaneous detection of waterborne viruses by multiplex real-time PCR. J Microbiol. 2013. 51: 671-675.
    Pubmed CrossRef
  13. Kopecka H, Brown B, Pallansch M. Genotypic variation in Coxsackievirus B5 isolates from three different outbreaks in the United States. Virus Res. 1995. 38: 125-136.
    Pubmed CrossRef
  14. Lee HK, Jeong YS. Comparison of total culturable virus assay and multiplex integrated cell culture-PCR for reliability of waterborne virus detection. Appl Environ Microbiol. 2004. 70: 3632-3636.
    Pubmed KoreaMed CrossRef
  15. Lee S, Cho KB. Development of Reverse Transcription Semi-nested PCR Primer Pairs for the Specific and Highly Sensitive Detection of Human Aichivirus A1. Biomed Sci Lett. 2019. 25: 331-338.
    CrossRef
  16. Lee S, Jang J, Bae K, Lee W, Chung H, Park S. Prevalence of human Norovirus by genotype in contaminated groundwater in Korea over the last decade (2007~2016). J Microbiol. 2018. 56: 926-931.
    Pubmed CrossRef
  17. Lee S, Kang EH, Chu YM, Shin YG, Ahn TY. Development of PCR diagnosis system for plant quarantine seed-borne Wheat streak mosaic virus. Korean J Microbiol. 2013. 49: 112-117.
    CrossRef
  18. Lee S, Kim JH, Choi JY, Jang WC. Loop-mediated isothermal amplification assay to rapidly detect Wheat streak mosaic virus in quarantined plants. Plant Pathol J. 2015. 31: 438-440.
    Pubmed KoreaMed CrossRef
  19. Lee S, Lee JY, Kim H, Kim JH, Rho JY. Development and Optimization of a Reverse Transcription Hemi-Nested PCR Primer for the Detection of Potato Mop-Top Virus at Quarantine Inspection Sites in Korea. Indian J Microbiol. 2017. 57: 253-256.
    Pubmed KoreaMed CrossRef
  20. Mohamed N, Elfaitouri A, Fohlman J, Friman G, Blomberg J. A sensitive and quantitative single-tube real-time reverse transcriptase-PCR for detection of enteroviral RNA. J Clin Virol. 2004. 30: 150-156.
    Pubmed CrossRef
  21. Oberste MS, Maher K, Kilpatrick DR, Pallansch MA. Molecular evolution of the human enteroviruses: correlation of serotype with VP1 sequence and application to Picornavirus classification. J Virol. 1999. 73: 1941-1948.
    Pubmed KoreaMed CrossRef
  22. Papa A, Dumaidi K, Franzidou F, Antoniadis A. Genetic variation of Coxsackievirus B5 strains associated with aseptic meningitis in Greece. Clin Microbiol Infection. 2006. 12: 688-691.
    Pubmed CrossRef
  23. Rezig D, Yahia AB, Abdallah HB, Bahri O, Triki H. Molecular characterization of Coxsackievirus B5 isolates. J Med Virol. 2004. 72: 268-274.
    Pubmed CrossRef
  24. Schneider L, Blakely H, Tripathi A. Mathematical model to reduce loop mediated isothermal amplification (LAMP) false-positive diagnosis. Electrophoresis. 2019. 40: 1-12.
    Pubmed KoreaMed CrossRef
  25. Tan EL, Yong LLG, Quak SH, Yeo WCA, Chow VTK, Poh CL. Rapid detection of Enterovirus 71 by real-time TaqMan RT-PCR. J Clin Virol. 2008. 42: 203-206.
    Pubmed CrossRef
  26. Triantafyllopoulou A, Tapinos N, Moutsopoulos HM. Evidence for Coxsackievirus infection in primary Sjögren's syndrome. Arthritis &. Rheumatism. 2004. 50: 2897-2902.
    Pubmed CrossRef
  27. Yoo JE, Lee C, Park S, Ko G. Evaluation of Various Real-Time Reverse Transcription Quantitative PCR Assays for Norovirus Detection. J Microbiol Biotechnol. 2017. 27: 816-824.
    Pubmed CrossRef
  28. Wagenknecht LE, Roseman JM, Herman WH. Increased incidence of insulin-dependent diabetes mellitus following an epidemic of Coxsackievirus B5. American J Epidemiol. 1991. 133: 1024-1031.
    Pubmed CrossRef
  29. Zhang G, Wilsden G, Knowles NJ, McCauley JW. Complete nucleotide sequence of a Coxsackie B5 virus and its relationship to Swine vesicular disease virus. J Gen Virol. 1993. 74: 845-853.
    Pubmed CrossRef
  30. Zhao G, Yin G, Zhao H, Li G, Meng B, Hu X, Li Y, Wang Y, Zhao H. Two reverse-transcription-loop-mediated isothermal amplification systems for highly sensitive detection of Enterovirus 71 and Coxsackievirus A16. Academic J. 2013. 7: 4443-4450.