Biomedical Science Letters

eISSN 2288-7415

Table. 1.

RT- and nested PCR information for the detection of human Sapovirus (HuSaV)

Division PCR type Primer information Length (nt) References Remark

Name Sequence (5'→5') Mer (nt) Location*

Start End
Candidate RT-nested PCR primer ses in this study RT-PCR primer set #1 RT-PCR SaV-F5098m GCYTGGTTYATAGGTGGTAC 20 5,098 5,117 781 This study SV-F11 base modified
SaV-R5878m CWGGTGAIMHICCATTKTCCAT 22 5,857 5,878 SV-R1 base modified

RT-PCR primer set #2 RT-PCR SaV-F5157m AITAGTGTTTGARATGGAGGG 21 5,157 5,177 435 This study SV-F21 base modified
SV-R2 GWGGGRTCAACMCCWGGTGG 20 5,572 5,591 [2,3] Same as reference

RT-PCR primer set #3 RT-PCR SaV-F5101m TGGTTYATAGGTGGTRCAG 19 5,101 5,119 778 This study SV-F11 base modified
SaV-R5878m CWGGTGAIMHICCATTKTCCAT 22 5,857 5,878 SV-R1 base modified

RT-PCR primer set #4 RT-PCR SaV-F5101m TGGTTYATAGGTGGTRCAG 19 5,101 5,119 491 This study SV-F11 base modified
SV-R2 GWGGGRTCAACMCCWGGTGG 20 5,572 5,591 [2,3] Same as reference

RT-PCR primer set #5 RT-PCR SaV-F5098m GCYTGGTTYATAGGTGGTAC 20 5,098 5,117 494 This study SV-F11 base modified
SV-R2 GWGGGRTCAACMCCWGGTGG 20 5,572 5,591 [2,3] Same as reference

Nested PCR primer set #1-1 Nested PCR SaV-F5101m TGGTTYATAGGTGGTRCAG 19 5,101 5,119 491 This study SV-F11 base modified
SV-R2 GWGGGRTCAACMCCWGGTGG 20 5,572 5,591 [2,3] Same as reference


Nested PCR primer set #1-2 SaV-F5098m GCYTGGTTYATAGGTGGTAC 20 5,098 5,117 494 This study SV-F11 base modified
SV-R2 GWGGGRTCAACMCCWGGTGG 20 5,572 5,591 [2,3] Same as reference


Nested PCR primer set #1-3 SaV-F5157m AITAGTGTTTGARATGGAGGG 21 5,157 5,177 435 This study SV-F21 base modified
SV-R2 GWGGGRTCAACMCCWGGTGG 20 5,572 5,591 [2,3] Same as reference

Reference RT or RT-nested PCR primer sets Ref.#1 RT-PCR SV-F21 (5157-5177) ANTAGTGTTTGARATGGAGGG 21 5,157 5,177 722 Shigemoto et al., 2011
SV-R1 (5857-5878) CWGGTGAMACMCCATTKTCCAT 22 5,857 5,878

Ref.#2 RT-PCR SV-F11 (5098-5117) GCYTTGTTYATAGGTGGTAC 20 5,098 5,117 781 Oka et al., 2015
SV-R1 (5857-5878) CWGCTGAMACMCCATTKTCCAT 22 5,857 5,878

Nested PCR SV-F21 (5157-5177) ANTAGTGTTTGARATGGAGGG 21 5,157 5,177 435
SV-R2 (5572-5591) GWGGGRTCAACMCCWGGTGG 20 5,572 5,591

Ref.#3 RT-PCR SV-F11 (5098-5117) GCYTTGTTYATAGGTGGTAC 20 5,098 5,117 781 Kitajima et al., 2010
SV-R1 (5857-5878) CWGCTGAMACMCCATTKTCCAT 22 5,857 5,878

Reference RT or RT-nested PCR primer sets Ref.#3 Nested PCR 1245Rfwd (5161-5177) TAGTGTTTGARATGGAGGG 19 5,159 5,177 433 Kitajima et al., 2010
SV-R2 (5572-5591) GWGGGRTCAACMCCWGGTGG 20 5,572 5,591

Ref.#4 RT-PCR SLV5317 CTCGCCACCTACRAWGCBTGGTT 23 5,083 5,105 434 Kumthip et al., 2020
SLV5749 CGGRCYTCAAAVSTACCBCCCCA 23 5,494 5,516

Ref.#5 RT-PCR SV-F14 (5074-) GAACAAGCTGTGGCATGCTAC 21 5,074 5,094 803 Liu et al., 2015
SV-R14 (-5876) GGTGAGMMYCCATTCTCCAT 20 5,857 5,876

Nested PCR SV-F22 (5154-) SMWAWTAGTGTTTGARATG 19 5,154 5,172 438
SV-R2 (-5591) GWGGGRTCAACMCCWGGTGG 20 5,572 5,591

Ref.#6 RT-PCR SR80 TGGGATTCTACACAAAACCC 20 4,366 4,385 320 Thwiny et al., 2015
JV33 GTGTANATGCARTCATCACC 20 4,666 4,685

Ref.#7 RT-PCR SLV5317 CTCGCCACCTACRAWGCBTGGTT 23 5,083 5,105 100 Khamrin et al., 2011
SMP-R CMWWCCCCTCCATYTCAAACAC 22 5,161 5,182

*Based on NCBI accession number KP298674.1

Biomed Sci Letters 2021;27:35-43 https://doi.org/10.15616/BSL.2021.27.1.35
© 2021 Biomed Sci Letters