Biomedical Science Letters

eISSN 2288-7415

Table. 2.

Primer sequences

Gene symbol Sense (5'-3') Antisense (5'-3')
EPO TACGTAGCCTCACTTCACTGCTT GCAGAAAGTAT CG TGTGAG TGT TC
EPOR AGGTGGACGTGTCAGCAGGC CGTACCTTGTGGCGTATGCAG
HIF-1a CACTGCACAGGCCACATTCAT AAGCAGGTCATAGGCGGTTTC
HIF-2a GTCACCAGAACTTGTGC CAAAGATGCTGTT
JAK-2 GGCAGCAGCAGAACCTAC GTCTAACACCGCCATCCC
VEGF AACGAAAGCGCAAGAAATCC GCTCACAGTGAACGCTCCAG
Actin CTTTCTACAATGAGCTGCGTG TCATGAGGTAGTCTGTCAGG

EPO, erythropoietin; EPOR, erythropoietin receptor; HIF, hypoxia inducible factor; JAK-2, janus kinase 2; VEGF, Vascular endothelial growth factor

Biomed Sci Letters 2021;27:69-76 https://doi.org/10.15616/BSL.2021.27.2.69
© 2021 Biomed Sci Letters