Biomedical Science Letters

eISSN 2288-7415

Table. 1.

RT/Nested PCR primer sets of Sapovirus and Norovirus GI · GII

Virus Target gene Type Name Sequence (5'→3') Polarity Location Size (bp) Remark
Sapovirus NS7-VP1 RT-PCR SV-F13 GAY YWG GCY CTC GCY ACC TAC + 5074~5094 803 KP298674.1
RT-PCR SV-R13 GGT GAN AYN CCA TTK TCC AT - 5857~5876
Nested PCR SV-F21 ANT AGT GTT TGA RAT GGA GGG + 5157~5177 435
Nested PCR SV-R2 GWG GGR TCA ACM CCW GGT GG - 5572~5591
Norovirus GI VP1 RT-PCR GI-F1M CTG CCC GAA TTY GTA AAT GAT GAT + 5339~5362 330 JQ388274.1
RT-PCR GI-R1M CCA ACC CAR CCA TTR TAC ATY TG - 5646~5668
Nested PCR GI-F2-U 1)AAT ACG ACT CAC TAT AGA TGA
TGA TGG CGT CTA AGG ACG C
+ 5355~5377 314
Nested PCR GI-R1M CCA ACC CAR CCA TTR TAC ATY TG - 5646~5668
Norovirus GII NS7-VP1 RT-PCR GII-F1M GGG AGG GCG ATC GCA ATC T + 5058~5076 341 KX356908.1
RT-PCR GII-R1M CCR CCI GCA TRI CCR TTR TAC AT - 5376~5398
Nested PCR GII-F3M TTG TGA ATG AAG ATG GCG TCG ART + 5088~5111 311
Nested PCR GII-R1M-U 2)GCG GAT AAC AAT TTC ACA CAG
GCC RCC IGC ART ICC RTT RTA CAT
- 5376~5398

1) Universal Primer (T7), AATACGACTCACTATAG (17 bp); 2) Universal Primer (M13R), GCGGATAACAATTTCACACAGG (22 bp)

Biomed Sci Letters 2022;28:83-91 https://doi.org/10.15616/BSL.2022.28.2.83
© 2022 Biomed Sci Letters