Biomedical Science Letters

eISSN 2288-7415

Table. 1.

Primer lists and sequence for RT-PCR

Primer Sequence (5' to 3')
β-actin Forward: CCAGTTGGTAACAATGCCATGT
Reverse: GGCTGTATTCCCCTCCATCG
TGFβ Forward: CGTCAGCCGATTTGCTATCT
Reverse: CGGACTCCGCAAAGTCTAAG
TNFα Forward: ATGAAAGTCTCTGCCGCCCTCA
Reverse: TCCTTGGCAAAACTGCACCT
p53 Forward: GGCCCACTTCACCGTACTAA
Reverse: GTGGTTTCAAGGCCAGATGT
Rb Forward: TGTATCGGCTAGCCTATCTC
Reverse: AATTAACAAGGTGTGGTGG
Bcl-2 Forward: CATGTGTGTGGAGAGCGTCAAC
Reverse: CAGATAGGCACCCAGGGTGAT
Bcl-xl Forward: CGGTACCGGCGGGCATTCAG
Reverse: CGGCTCTCGGCTGCTGCATT
Bax Forward: TTTGCTTCAGGGTTTCATCCA
Reverse: CTCCATGTTACTGTCCAGTTCGT
Bcl6 Forward: CTGCAGATGGAGCATGTTGT
Reverse: TCTTCACGAGGAGGCTTGAT
Sod2 Forward: CTGAGGAGAGCAGCGGTCGT
Reverse: CTTGGCCAGCGCCTCGTGGT
GADD45 Forward: CGTTTTGCTGCGAGAACGAC
Reverse: GAACCCATTGATCCATGTAG
CAT Forward: GCGAATGGAGAGGCAGTGTAC
Reverse: GAGTGAGTTGTCTTCATTAGCACTG

*Abbreviations: Beta-actin (β-actin), Transforming Growth Factor-β (TGF-β), Tumor Necrosis Factor (TNF-α), Tumor protein p53 (p53) Retinoblastoma protein (Rb), B-cell lymphoma 2 (Bcl-2), B-cell lymphoma-extra large (Bcl-xl), Bcl-2-associated X protein (Bax), B-cell lymphoma 6 (Bcl6), Superoxide Dismutase 2 (SOD2), Growth Arrest and DNA Damage-inducible 45 (GADD45), Catalase (CAT)

Biomed Sci Letters 2022;28:92-100 https://doi.org/10.15616/BSL.2022.28.2.92
© 2022 Biomed Sci Letters