Biomedical Science Letters

eISSN 2288-7415

Table. 1.

Oligonucleotide sequences for O-serotyping of UPEC

Serogroup Primer Primer sequence (5'-3') Amplicon size (bp) Target gene Conc. in multiplex PCR (μM) Reference
Group 1 Li et al., 2010
O1 wl-14632-(F) GTGAGCAAAAGTGAAATAAGGAACG 1,098 wzx 0.05
wl-14633-(R) CGCTGATACGAATACCATCCTAC
O6 wl-14646-(F) GGATGACGATGTGATTTTGGCTAAC 783 wzy 0.07
wl-14647-(R) TCTGGGTTTGCTGTGTATGAGGC
O7 wl-14648-(F) CTATCAAAATACCTCTGCTGGAATC 610 wzy 0.12
wl-14649-(R) TGGCTTCGAGATTAAACCTATTCCT
O8 wl-14652-(F) CCAGAGGCATAATCAGAAATAACAG 448 orf469 0.12
wl-14653-(R) GCAGAGTTAGTCAACAAAAGGTCAG
O16 wl-14654-(F) GGTTTCAATCTCACAGCAACTCAG 302 wzx 0.13
wl-14655-(R) GTTAGAGGGATAATAGCCAAGCGG
O21 wl-14676-(F) CTGCTGATGTCGCTATTATTGCTG 209 wzx 0.12
wl-14677-(R) TGAAAAAAAGGGAAACAGAAGAGCC
O75 wl-17413-(F) GAGATATACATGGGGAGGTAGGCT 511 wzx 0.07
wl-17414-(R) ACCCGATAATCATATTCTTCCCAAC
Group 2
O2 wl-14636-(F) AGTGAGTTACTTTTTAGCGATGGAC 770 wzy 0.07
wl-14637-(R) AGTTTAGTATGCCCCTGACTTTGAA
O4 wl-14642-(F) TTGTTGCGATAATGTGCATGTTCC 664 wzy 0.07
wl-14643-(R) AATAATTTGCTATACCCACACCCTC
O15 wl-14672-(F) TCTTGTTAGAGTCATTGGTGTATCG 183 wzy 0.08
wl-14673-(R) ATAAAACGAGCAAGCACCACACC
O18 wl-14656-(F) GTTCGGTGGTTGGATTACAGTTAG 551 wzx 0.08
wl-14657-(R) CTACTATCATCCTCACTGACCACG
O22 wl-14660-(F) TTCATTGTCGCCACTACTTTCCG 468 wzx 0.08
wl-14661-(R) GAAACAGCCCATGACATTACTACG
O25 wl-14666-(F) AGAGATCCGTCTTTTATTTGTTCGC 230 wzy 0.08
wl-14667-(R) GTTCTGGATACCTAACGCAATACCC
O83 wl-14668-(F) GTACACCAGGCAAACCTCGAAAG 362 wzx 0.08
wl-14669-(R) TTCTGTAAGCTAATGAATAGGCACC
Biomed Sci Letters 2022;28:127-36 https://doi.org/10.15616/BSL.2022.28.2.127
© 2022 Biomed Sci Letters