Biomedical Science Letters

eISSN 2288-7415

Table. 2.

Oligonucleotide sequences for amplification of the virulence factors genes and phylogenetic groups

Primer Primer sequence (5'-3') Amplicon size (bp) Target gene Reference
VFs pap1 GACGGCTGTACTGCAGGGTGTGGCG 328 papC Adamus-Bialek et al., 2009
pap2 ATATCCTTTCTGCAGGGATGCAATA
sfa1 CTCCGGAGAACTGGGTGCATCTTAC 410 sfaD/sfaE
sfa2 CGGAGGAGTAATTACAAACCTGGCA
cnf1a AAGATGGAGTTTCCTATGCAGGAG 498 cnf1
cnf12a CATTCAGAGTCCTGCCCTCATTATT
usp1mod TTCTGGGGAACTGACATTCACGG 657 usp
usp2mod CCTCAGGGACATAGGGGGAA
fimGH1 GCAATGTTGGCGTTCGCAAGTGC 1,001 fimG/fimH
fimGH2 CGTAAATATTCCACACAAACTGG
hly1mod AACAACGATAAGCACTGTTCTGGCT 1,177 hlyA
hly2mod ACCATATAAGCGGTCATTCCCATCA
PGs TspE4C1 GAGTAATGTCGGGGCATTCA 152 TSPE4.C2 Clermont et al., 2000
TspE4C2 CGCGCCAACAAAGTATTACG
YjA1 TGAAGTGTCAGGAGACGCTG 211 yjaA
YjA2 ATGGAGAATGCGTTCCTCAAC
ChuA1 GACGAACCAACGGTCAGGAT 279 chuA
ChuA2 TGCCGCCAGTACCAAAGACA

Abbreviation: VFs, virulence factor; PG, phylogenetic group

Biomed Sci Letters 2022;28:127-36 https://doi.org/10.15616/BSL.2022.28.2.127
© 2022 Biomed Sci Letters