Biomedical Science Letters

eISSN 2288-7415

Table. 2.

Primer sequence

Primer Forward (5'-3') Reverse (5'-3')
GAPDH AGGGCTGCTTTTAACTCTGGT CCCCACTTGATTTTGGAGGGA
FLRT3 GTAACAGGGGAACHCAGTGA AAAGGTAACCAGGGCCACAG
Biomed Sci Letters 2023;29:336-43 https://doi.org/10.15616/BSL.2023.29.4.336
© 2023 Biomed Sci Letters