Biomedical Science Letters

eISSN 2288-7415

Table. 1.

Sequences of primers used for the RT-PCR assays

 Genes Gene bank  Primer sequences
Mouse
 aP2NM_024406.2Forward : 5’- CCAAATGTGTGATGCCTTTGTG -3’
Reverse : 5’- CTCTTCCTTTGGCTCATGCC -3’
 ß-actinNM_007393.5Forward : 5’- TGGAATCCTGTGGCATCCATGAAA -3’
Reverse : 5’- TAAAACGCAGCTCAGTAACAGTCCG -3’
 C/EBPαNM_001287514.1Forward : 5’- AAGTCTTAGCCGGAGGAAGC -3’
Reverse : 5’- ATCCAGAGGGACTGGAGTT -3’
 PPARγNM_001308354.1Forward : 5’- ATTCTGGCCCACCAACTTCGG -3’
Reverse : 5’- TGGAAGCCTGATGCTTTATCCCCA -3’
Human
 aP2NM_001442.2Forward : 5’- TCCAGTGAAAACTTTGATGATTAT -3’
Reverse : 5’- ACGCATTCCACCACCAGTTTA -3’
 β-actinNM_001101.3Forward : 5’- GCAAGAGAGGCATCCTCACC -3’
Reverse : 5’- CGTAGATGGGCACAGTGTGG -3’
 C/EBPαNM_004364.4Forward : 5’- GTGGAGACGCAGCAGAAG -3’
Reverse : 5’- TTCCAAGGCACAAGGTTATC -3’
 PPARγNM_138711.3Forward : 5’- GCAGGAGCAGAGCAAAGAGGTG -3’
Reverse : 5’- AAATATTGCCAAGTCGCTGTCATC -3’
Biomed Sci Letters 2017;23:261-71 https://doi.org/10.15616/BSL.2017.23.3.261
© 2017 Biomed Sci Letters