Search for


TEXT SIZE

search for



Korean Red Ginseng (Panax ginseng) Potentiates the Inhibitory Actions of Testosterone on Obesity and Adipogenesis in High Fat Diet-Fed Castrated Mice
Biomed Sci Letters 2017;23:261-271
Published online September 30, 2017;  https://doi.org/10.15616/BSL.2017.23.3.261
© 2017 The Korean Society For Biomedical Laboratory Sciences.

Dongmin Park, and Michung Yoon

Department of Biomedical Engineering, Mokwon University, Daejeon 35349, Korea
Correspondence to: Michung Yoon. Department of Biomedical Engineering, Mokwon University, Daejeon 35349, Korea.Tel: +82-42-829-7581, Fax: +82-42-829-7580, e-mail: yoon60@mokwon.ac.kr
Received June 11, 2017; Revised August 16, 2017; Accepted August 20, 2017.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
 Abstract

It has been suggested that ginseng is beneficial for ameliorating the aging males’ symptoms, such as weight gain, fatigue, erectile dysfunction, and depression, in elderly men with testosterone deficiency. We thus investigated the effects of Korean red ginseng (Panax ginseng C.A. Meyer; Araliaceae) on obesity in a mouse model of testosterone deficiency (castrated C57BL/6J mice). The effects of ginseng extract (GE) and/or testosterone on obesity and adipogenesis in high-fat diet (HFD)-fed castrated C57BL/6J mice and 3T3-L1 adipocytes were examined using in vivo and in vitro approaches. After feeding mice a HFD for 8 weeks, we found that mice also receiving GE and/or testosterone showed decreased body weight, adipose tissue mass, adipocyte size, and hepatic lipid accumulation compared with untreated HFD-fed mice. Expression of adipogenic genes (PPARγ, C/EBPα, and aP2) was decreased by GE and/or testosterone in adipose tissues. Consistent with the in vivo data, lipid accumulation and the mRNA expression of adipogenesis genes in 3T3-L1 adipocytes were decreased by GE, ginsenosides, and testosterone. The inhibitory effects of GE (or ginsenosides) were comparable to those of testosterone, and the effects of co-treatment with GE (or ginsenosides) and testosterone were greater than those of testosterone alone in vivo and in vitro. Our results indicate that ginseng may be able to potentiate the inhibitory effects of testosterone on obesity and adipogenesis in HFD-fed castrated mice, providing possible therapeutic implications in men with testosterone deficiency.

Keywords : 3T3-L1 cell, Adipogenic gene, Ginsenosides, Lipid accumulation, Testosterone deficiency
INTRODUCTION

A growing body of evidence suggests that obesity in the aging men is deeply associated with lowered testosterone levels (Michalakis et al., 2013; Fui et al., 2014; Traish, 2014; Kelly and Jones, 2015). Low testosterone levels induce increased fat mass and testosterone therapy in men with testosterone deficiency results in weight loss and a lower risk of metabolic syndrome (Yassin and Doros, 2013; Francomano et al., 2014; Kelly and Jones, 2015). In mouse studies, knockout of the gene encoding the androgen receptor results in obesity, whereas overexpression of the androgen receptor results in decreased adipose tissue mass (Rana et al., 2011; Semirale et al., 2011; McInnes et al., 2012; Varlamov et al., 2012).

Ginseng has widely been used as a valuable medicine in Korea, China, and Japan for a long period (Yun, 2001; Yin et al., 2008; Park et al., 2012). Pharmacological studies have described the effects of ginseng on the central nervous, endocrine, immune, and cardiovascular systems (Gillis, 1997; Attele et al., 1999; Lu et al., 2009). In addition, ginseng has been suggested to reduce weight gain in animal models of obesity and can effectively regulate genes involved in obesity (Attele et al., 2002; Kim et al., 2005; Karu et al., 2007; Mollah et al., 2009; Lee et al., 2009, 2012). Ginseng also significantly inhibits visceral obesity and adipocyte hypertrophy (Lee et al., 2013, 2014, 2016), which is closely associated with metabolic syndromes (Okuno et al., 1998; Jeong and Yoon, 2009; Lee et al., 2014).

Clinical reports suggested the favorable effects of ginseng on aging males’ symptoms (AMS) and male sexual function (Choi et al., 2013; Ernst et al., 2011; Khera and Goldstein, 2011; Moyad and Park, 2012). AMS include testosterone deficiency, erectile dysfunction, depression, fatigue, weight gain, osteoporosis, and type 2 diabetes. Korean red ginseng (Panax ginseng C.A. Meyer; Araliaceae) and Malaysian ginseng increased the serum testosterone concentrations and improved the erectile function compared with placebo when administered to patients with testosterone deficiency (de Andrade et al., 2007; Ham et al., 2009; Tambi et al., 2012; Choi et al., 2013; Jung et al., 2016), indicating the testosterone-enhancing effects of ginseng. Thus, we hypothesized that Korean red ginseng is able to induce weight loss and regulate obesity in castrated male mice, an animal model of men with testosterone deficiency, by regulating the expression of adipogenesis-related genes.

In this study, we examined the effects of Korean red ginseng extract (GE) and/or testosterone on obesity and adipogenesis in high-fat diet (HFD)-fed castrated C57BL/6J mice and 3T3-L1 adipocytes. Our findings suggest that ginseng can enhance the actions of testosterone on obesity and adipogenesis in testosterone deficiency.

MATERIALS AND METHODS

GE Preparation

The GE was prepared from 6-year-old Panax ginseng C. A. Meyer (Korea Ginseng Corporation, Seoul, Korea). A voucher specimen was deposited at the laboratory of Korea Ginseng Corporation and the batch number of ginseng used in our study is 6510100112048. Briefly, red ginseng was boiled in distilled water for 24 h at 95°. The aqueous extracts were filtered and freeze-dried under vacuum to produce GE powder.

For analysis of the quality of GE, GE powder (100 g) was placed into a 1-L flask with a refluxing condenser and extracted twice with 500 mL of water-saturated 1-butanol for 1 h at 80°. The extracted solution was passed through Whatman filter paper (No. 41) after cooling. The process was repeated twice. The residue and filter paper were washed with 100 mL of water-saturated 1-butanol, and then the filtrate was washed twice with 100 mL of water in a 2-L separating funnel. The butanol layer was then evaporated to dryness. The concentrate was extracted to remove any traces of fat with 100 mL of diethyl ether for 30 min at 36° in a flask with a refluxing condenser, after which the ether solution was decanted. The quality control of GE was analyzed by the HPLC/ELSD system and the HPLC profile of GE was described previously (Lee et al., 2014).

Animal treatments

For all experiments, 8-week-old male wild-type C57BL/6J mice were housed and bred at Mokwon University with a standard 12-h light/dark cycle. Prior to the administration of a special diet, the mice were given standard rodent chow and water ad libitum. The mice were castrated and then divided into five groups (n = 8/group). The first group received a low-fat diet (LFD, 10% kcal fat, Research Diets, Brunswick, NJ, USA). The second group received an HFD (45% kcal fat, Research Diets). The third group received an HFD supplemented with 0.5% GE (w/w). 50 g GE powder was mixed with 1 kg HFD. The fourth group was fed an HFD and subcutaneously implanted with a testosterone pellet (5 mg testosterone per pellet, Innovative Research of America, Sarasota, FL, USA). The final group received an HFD supplemented with GE and the testosterone implant. After an 8-h fast on the last day of the study, the animals were sacrificed by cervical dislocation. Fat pads were removed, weighed, snap-frozen in liquid nitrogen, and stored at -80° until use. Portions of the fat pads and liver tissues were prepared for histology. All animal experiments were approved by the Institutional Animal Care and Use Committees of Mokwon University and were carried out in accordance with the National Research Council Guidelines.

Histological analysis

The adipose tissues were fixed in 10% phosphate-buffered formalin for 1 day and processed for paraffin sections. Tissue sections (5 μm) were cut and stained with hematoxylin and eosin for examination by microscopy. To quantify adipocyte size, the stained sections were analyzed using the Image-Pro Plus analysis system (Media Cybernetics, Bethesda, MD, USA).

3T3-L1 differentiation and analysis of triglyceride content

Murine 3T3-L1 cells (ATCC, Manassas, VA, USA) were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% bovine calf serum (Invitrogen, Carlsbad, CA, USA). The cells were maintained at confluence for 2 days, after which the medium was replaced with DMEM containing 0.5 mM 1-methyl-3-isobutyl-xanthine, 1 μM dexamethasone, and 1 μg/ml insulin, and 10% fetal bovine serum (Invitrogen) (day 0). The cultures were incubated for 2 days to induce adipocyte differentiation, and then the medium was replaced with DMEM containing 10% fetal bovine serum for the remainder of the differentiation process. The cells were treated with 10 μg/ml GE, 10 μg/ml ginsenosides, and/or 100 nM testosterone on days 0~2 only, and the medium was changed every other day (Singh et al., 2006; Oh et al., 2012). On day 8, the cells were fixed in 10% formalin for 1 h and stained with Oil Red O for 2 h. For quantitative analysis, the Oil Red O stain was eluted by adding isopropanol and quantified by measuring absorbance at 520 nm.

Reverse transcription-polymerase chain reaction

Total cellular RNA was extracted from VSC adipose tissues and 3T3-L1 cells using TRIzol reagent (Gibco-BRL, Grand Island, NY, USA). The RNA (2 μg) was denatured for 5 min at 72° and then immediately placed on ice for 5 min. To generate cDNA, the denatured RNA was mixed with Moloney murine leukemia virus reverse transcriptase, buffer, and a deoxyribonucleotide triphosphate (dNTP) mixture and incubated for 1 h at 42°. The cDNA was mixed with PCR primers, Taq DNA polymerase (NanoHelix, Daejeon, Korea), and dNTPs and amplified in an MJ Research thermal cycler (Waltham, MA, USA). The PCR primers are shown in Table 1. The PCR products were analyzed by electrophoresis in a 1% agarose gel and quantified using the GeneGenius bio-imaging system (Syngene, Cambridge, UK). Relative expression levels are presented as the ratio of target gene cDNA to β-actin cDNA.

Sequences of primers used for the RT-PCR assays

 Genes Gene bank  Primer sequences
Mouse
 aP2NM_024406.2Forward : 5’- CCAAATGTGTGATGCCTTTGTG -3’
Reverse : 5’- CTCTTCCTTTGGCTCATGCC -3’
 ß-actinNM_007393.5Forward : 5’- TGGAATCCTGTGGCATCCATGAAA -3’
Reverse : 5’- TAAAACGCAGCTCAGTAACAGTCCG -3’
 C/EBPαNM_001287514.1Forward : 5’- AAGTCTTAGCCGGAGGAAGC -3’
Reverse : 5’- ATCCAGAGGGACTGGAGTT -3’
 PPARγNM_001308354.1Forward : 5’- ATTCTGGCCCACCAACTTCGG -3’
Reverse : 5’- TGGAAGCCTGATGCTTTATCCCCA -3’
Human
 aP2NM_001442.2Forward : 5’- TCCAGTGAAAACTTTGATGATTAT -3’
Reverse : 5’- ACGCATTCCACCACCAGTTTA -3’
 β-actinNM_001101.3Forward : 5’- GCAAGAGAGGCATCCTCACC -3’
Reverse : 5’- CGTAGATGGGCACAGTGTGG -3’
 C/EBPαNM_004364.4Forward : 5’- GTGGAGACGCAGCAGAAG -3’
Reverse : 5’- TTCCAAGGCACAAGGTTATC -3’
 PPARγNM_138711.3Forward : 5’- GCAGGAGCAGAGCAAAGAGGTG -3’
Reverse : 5’- AAATATTGCCAAGTCGCTGTCATC -3’

Statistical analysis

All values are expressed as mean ± standard deviation (SD). Groups were compared by analysis of variance followed by Tukey’s multiple comparison test; P<0.05 was considered significant.

RESULTS

Effects of GE and testosterone on body weight and adiposity in HFD-fed castrated mice

Body weight and adipose tissue mass were measured in male castrated C57BL/6J mice on an LFD, HFD, and HFD containing GE with or without testosterone for 8 weeks. The mean body weight of untreated HFD-fed mice was 38.4 ± 1.33 g (Fig. 1A). However, the body weights of HFD-fed mice treated with GE or testosterone were 31.02 ± 1.35 g and 30.08 ± 2.32 g, respectively, representing decreased body weights of 19% and 22% compared with mice fed the HFD (P<0.05). Furthermore, the body weight of HFD-fed mice concomitantly treated with GE and testosterone was 26.96 ± 1.62 g, representing a decreased body weight of 13% by compared with HFD plus testosterone (P<0.05). Treatment with GE and/or testosterone also led to decreased adipose tissue mass in HFD-fed mice. Adipose tissue weights of HFD-fed mice treated with GE or testosterone were 37% or 65% lower than that of untreated HFD-fed mice (P<0.05, Fig. 1B). Combined treatment with GE and testosterone further decreased fat weight by 72% compared with HFD-fed mice receiving testosterone only (P<0.05).

Fig. 1.

Regulation of body weight and adipose tissue mass by ginseng extract (GE) and testosterone (T) in high-fat diet (HFD)-fed castrated mice. Mice (n = 8/group) were fed a low-fat diet (LFD), HFD, or HFD supplemented with GE and/or T for 8 weeks. (A) Body weight and (B) adipose tissue mass at the end of the treatment period. All values are expressed as mean ± SD. #P<0.05 versus LFD group. *P<0.05 versus HFD group. **P<0.05 versus T group.


Effects of GE and testosterone on adipocyte size in HFDfed castrated mice

Histological analysis revealed that GE and/or testosterone treatment decreased mean adipocyte size in HFD-fed mice. The adipocyte size decreased by 47% or 69% in HFD-fed mice receiving either GE (6,053 ± 689 μm2) or testosterone (3,819 ± 379 μm2), compared with that of untreated HFD-fed mice (11,517 ± 731 μm2; P<0.05; Fig. 2). Cotreatment with GE and testosterone (1,695 ± 78 μm2) further decreased the mean adipocyte size by 53% compared with that of HFD-fed mice receiving testosterone only (P<0.05).

Fig. 2.

Regulation of adipocyte size by ginseng extract (GE) and testosterone (T) in high-fat diet (HFD)-fed castrated mice. Mice (n = 8/group) were fed a low-fat diet (LFD), HFD, or HFD supplemented with GE and/or T for 8 weeks. (A) Representative hematoxylin and eosin-stained sections (5 μm thick) of adipose tissue. (B) Adipocyte size. We measured adipocyte size in a fixed area (1,000,000 μm2). All values are expressed as mean ± SD. #P<0.05 versus LFD group. *P<0.05 versus HFD group. **P<0.05 versus T group.


Effects of GE and testosterone on expression of adipogenesis-associated genes in adipose tissues of HFD-fed castrated mice

Expression patterns of genes involved in adipogenesis were investigated in adipose tissues of the castrated mice. GE administration decreased mRNA levels of peroxisome proliferator-activated receptor γ (PPARγ), CCAAT/enhancer-binding protein α (C/EBPα), and adipocyte fatty acid-binding protein 2 (aP2) in the adipose tissue of untreated HFD-fed mice, and testosterone decreased PPARγ and aP2 mRNA levels (P<0.05; Fig. 3). Co-administration of GE and testosterone decreased C/EBPα and aP2 mRNA levels compared with HFD-fed mice treated with testosterone alone (P<0.05).

Fig. 3.

Effects of ginseng extract (GE) and testosterone (T) on adipogenesis-associated gene expression in high-fat diet (HFD)-fed castrated mice. (A) Mice were fed a low-fat diet (LFD), HFD, or HFD supplemented with GE and/or T for 8 weeks. Relative mRNA levels of PPARγ, C/EBPα, and aP2 are expressed as mean ± SD using β-actin as a reference gene. #P<0.05 versus LFD group. *P<0.05 versus HFD group. **P<0.05 versus T group. (B) Representative RT-PCR bands from one of three independent experiments are shown.


Inhibition of lipid accumulation by GE, ginsenosides, and testosterone in 3T3-L1 adipocytes

We then examined the ability of GE (10 μg/ml), ginsenosides (10 μg/ml), and testosterone (100 nM) to prevent lipid accumulation in 3T3-L1 cells. After incubation in differentiation medium, the untreated 3T3-L1 cells (control) showed a marked accumulation of lipid droplets, as shown by the increase in Oil Red O staining (Fig. 4A). However, treatment with GE, ginsenosides, or testosterone decreased lipid accumulation by 34%, 52%, and 48%, respectively, compared with the control (Fig. 4B). Combination treatment with ginsenosides and testosterone further decreased triglyceride content compared with testosterone alone.

Fig. 4.

Effects of ginseng extract (GE), ginsenosides (GSs), and testosterone (T) on lipid accumulation in 3T3-L1 cells. (A) The 3T3-L1 preadipocytes were differentiated into mature adipocytes and then treated with GE, GSs, and/or T. At day 8 post-induction, the cells were fixed, and neutral lipids were stained with Oil Red O (representative cells are shown). (B) Quantitative analysis of triglyceride content. All values are expressed as mean ± SD. *P<0.05 versus control. **P<0.05 versus T group.


Effects of GE, ginsenosides, and testosterone on adipogenic gene expression in 3T3-L1 adipocytes

Treatment with GE, ginsenosides, or testosterone also decreased the expression of adipogenic genes compared with the control (Fig. 5). Treatment with GE decreased mRNA levels of C/EBPα and aP2, and ginsenosides decreased mRNA levels of PPARγ, C/EBPα, and aP2 (P<0.05). The inhibitory effects of ginsenosides were greater than those of GE. Testosterone treatment also decreased mRNA levels of all three genes. Co-treatment with ginsenosides and testosterone decreased mRNA levels of PPARγ, C/EBPα, and aP2 compared with testosterone alone (P<0.05).

Fig. 5.

Effects of ginseng extract (GE), ginsenosides (GSs), and testosterone (T) on adipocyte-specific gene expression in 3T3-L1 cells. (A) The 3T3-L1 preadipocytes were differentiated into mature adipocytes and then treated with GE, GSs, and/or T. Relative mRNA levels of PPARγ, C/EBPα, and aP2 are expressed as mean ± SD using β-actin as a reference gene. *P<0.05 versus control. **P<0.05 versus T group. (B) Representative RT-PCR bands from one of three independent experiments are shown.


DISCUSSION

Based on reports showing that low testosterone leads to obesity and its related metabolic diseases (Fui et al., 2014; Kelly and Jones, 2015) and that GE enhances testosterone effects in men with testosterone deficiency (de Andrade et al., 2007; Ham et al., 2009; Tambi et al., 2012; Jung et al., 2016), we examined the effects of ginseng on obesity and adipogenesis in testosterone-deficient castrated mice. Our results indicate that both GE and testosterone can prevent adipogenesis, adiposity, and obesity in HFD-fed castrated mice, and these effects are mediated in part through reducing the expression of adipogenic genes. Our findings also suggest that GE may be able to potentiate the inhibitory effects of testosterone on obesity and adipogenesis in obese castrated mice.

We found that 8 weeks of HFD feeding resulted in increased body weight in castrated mice (38.4 ± 1.33 g) compared with sham-operated mice (33.44 ± 2.24 g), as well as increased adipose tissue mass (data not shown), consistent with previous studies reporting that testosterone deficiency leads to obesity. Administration of GE significantly decreased body weight and adipose tissue mass in the HFD-fed castrated mice by 19% and 37%, respectively, compared with untreated HFD-fed castrated mice. Our results are supported by previous reports showing that GE induced weight loss in several animal models of genetically and diet-induced obesity (Mollah et al., 2008; Lee et al., 2009, 2012, 2013). Weight loss was also observed with testosterone treatment, which decreased body weight and adipose tissue mass by 22% and 65%, respectively, in HFD-fed castrated mice. Testosterone plays a key role in the pathology of metabolic diseases such as obesity, and low testosterone levels are associated with increased fat mass and reduced lean mass in adult males (Kelly and Jones, 2015). In men with testosterone deficiency, testosterone therapy can produce significant and sustained weight loss, lower BMI, and decrease waist circumference (Yassin and Doros, 2013; Francomano et al., 2014), with the increase in testosterone proportional to the amount of weight loss. Moreover, body and adipose tissue weights in mice treated with the combination of GE and testosterone were lower than that of mice treated with testosterone alone.

In our study, we found that adipocytes were smaller in GE- or testosterone-treated HFD-fed mice than in untreated HFD-fed mice, and co-treatment with GE and testosterone further decreased adipocyte size compared with testosterone treatment alone. These results indicate that GE and testosterone effectively inhibit adipocyte hypertrophy in HFD-fed castrated mice and that GE potentiates the ability of testosterone to inhibit adipocyte hypertrophy. Adipocyte hypertrophy is closely related to metabolic syndromes, such as insulin resistance, type 2 diabetes, hypertension, atherosclerosis, dyslipidemia, and nonalcoholic fatty liver disease. The hypertrophied adipocytes secrete large amounts of inflammatory cytokines such as monocyte chemoattractant protein-1 (MCP-1), which stimulates macrophage infiltration in mice and humans (Xu et al., 2003; Curat et al., 2004). This inflammatory response ultimately leads to the deposition of ectopic fat in liver, muscle, and pancreas (Bluher, 2009). Visceral adipocytes in obese individuals are insulin resistant, possibly as a consequence of adipose cell expansion. Large adipocytes increase the levels of circulating free fatty acids, tumor necrosis factor α, and leptin, which are associated with insulin resistance (Okuno et al., 1998; Jeong and Yoon, 2009; Oh et al., 2015). Therefore, GE and testosterone may alleviate metabolic disease by inhibiting adipocyte hypertrophy.

Adipogenesis involves excess fat accumulation and lipogenic gene expression during differentiation of preadipocytes into mature adipocytes (Rosen and Spiegelman, 2000). PPARγ and C/EBPα are major transcription factors of early-stage adipocyte differentiation. Their expression activates the target gene aP2, which plays a role in lipogenesis (Rosen et al., 1999). Based on their ability to decrease body weight and adipocyte size, we hypothesized that GE and testosterone regulate the expression of adipogenesis-associated genes. Our results showed that GE and testosterone negatively regulate the expression of PPARγ, C/EBPα and aP2 in the adipose tissue of castrated mice, and co-administration of GE and testosterone further decreased adipogenic gene expression compared with testosterone alone. Our findings are supported by previous studies describing that red ginseng downregulates PPARγ and aP2 expression in adipose tissue of rats with HFD-induced obesity (Jung et al., 2015) and androgens such as testosterone and dihydrotestosterone downregulate PPARγ and C/EBPα expression in human adipose stem cells (Chazenbalk et al., 2013). These results support our hypothesis that decreased body weight gain, adipose tissue mass, and adipocyte size following GE and testo sterone treatments are due to the downregulation of adipogenesis genes.

We showed that in vitro adipogenesis is inhibited by GE, ginsenosides, and testosterone by staining 3T3-L1 adipocytes with Oil Red O. Ginsenosides, which comprise approximately 3~6% of ginseng, were more effective than GE in preventing the accumulation of intracellular triglycerides, likely because ginsenosides exert most of the pharmacological activity of ginseng (Attele et al., 1999; Huang, 1999). Co-treatment with ginsenosides and testosterone further decreased lipid content in 3T3-L1 cells compared with testosterone alone. In parallel with the reduced lipid accumulation, treatment with ginsenosides or testosterone decreased PPARγ, C/EBPα, and aP2 expression in 3T3-L1 cells, and co-treatment with ginsenosides and testosterone further decreased expression of these genes compared with testosterone alone. Our data are consistent with several reports demonstrating that individual ginsenosides (Rb1, Rc, and Rf) inhibit adipogenic activities by downregulating PPARγ, C/EBPα, and aP2 in 3T3-L1 cells (Oh et al., 2012; Siraj et al., 2015; Yang and Kim, 2015), and a study reporting that testosterone inhibits adipogenic differentiation and decreases C/EBPα and PPARγ2 protein and mRNA levels in 3T3-L1 cells (Singh et al., 2006). Taken together, our in vitro data support the in vivo results showing that GE and testosterone inhibit adipogenesis and obesity by downregulating adipogenesis-related genes.

In conclusion, the results of our study show that ginseng and testosterone can prevent obesity and adipogenesis in HFD-fed male castrated mice and suggest that these processes are mediated in part by the inhibition of adipogenesis gene expression. The inhibitory effects of GE (and ginsenosides) on obesity were comparable to those of testosterone. In addition, combination treatment provided effects greater than those of testosterone alone, indicating that ginseng may be able to replace or potentiate the inhibitory actions of testosterone on obesity and adipogenesis. Our findings suggest that ginseng may act as an anti-obesity drug in men with testosterone deficiency.

ACKNOWLEDGEMENTS

This work supported by the National Research Foundation of Korea (NRF) Grant funded by the Korea Government (MEST) (2015R1A1A3A04001016).

CONFLICT OF INTEREST

The author declares no conflict of interest.

References
  1. Attele AS, Wu JA, and Yuan CS. Ginseng pharmacology:multiple constituents and multiple actions. Biochemical Pharmacology 1999;58:1685-1693.
    CrossRef
  2. Attele AS, Zhou YP, Xie JT, Wu JA, Zhang L, Dey L, Pugh W, Rue PA, Polonsky KS, and Yuan CS. Antidiabetic effects of Panax ginseng berry extract and the identification of an effective component. Diabetes 2002;51:1851-1858.
    Pubmed CrossRef
  3. Bluher M. Adipose tissue dysfunction in obesity. Experimental and Clinical Endocrinology & Diabetes 2009;117:241-250.
    Pubmed CrossRef
  4. Chazenbalk G, Singh P, Irge D, Shah A, Abbott DH, and Dumesic DA. Androgens inhibit adipogenesis during human adipose stem cell commitment to preadipocyte formation. Steroids 2013;2009:920-926.
    Pubmed KoreaMed CrossRef
  5. Choi YD, Park CW, Jang J, Kim SH, Jeon HY, Kim WG, Lee SJ, and Chung WS. Effects of Korean ginseng berry extract on sexual function in men with erectile dysfunction:a multicenter, placebo-controlled, double-blind clinical study. International Journal of Impotence Research 2013;25:45-50.
    Pubmed CrossRef
  6. Curat CA, Miranville A, Sengenes C, Diehl M, Tonus C, Busse R, and Bouloumie A. From blood monocytes to adipose tissueresident macrophages:induction of diapedesis by human mature adipocytes. Diabetes 2004;53:1285-1292.
    Pubmed CrossRef
  7. de Andrade E, de Mesquita AA, Claro Jde A, de Andrade PM, Ortiz V, Paranhos M, and Srougi M. Study of the efficacy of Korean Red Ginseng in the treatment of erectile dysfunction. Asian Journal of Andrology 2007;9:241-244.
    Pubmed CrossRef
  8. Ernst E, Posadzki P, and Lee MS. Complementary and alternative medicine (CAM) for sexual dysfunction and erectile dysfunction in older men and women:an overview of systematic reviews. Maturitas 2011;70:37-41.
    Pubmed CrossRef
  9. Francomano D, Lenzi A, and Aversa A. Effects of five-year treatment with testosterone undecanoate on metabolic and hormonal parameters in ageing men with metabolic syndrome. International Journal of Endocrinology 2014;2014:527470.
  10. Fui MN, Dupuis P, and Grossmann M. Lowered testosterone in male obesity:mechanisms, morbidity and management. Asian Journal of Andrology 2014;16:223-231.
    Pubmed KoreaMed CrossRef
  11. Gillis CN. Panax ginseng pharmacology:a nitric oxide link?. Biochemical Pharmacology 1997;54:1-8.
    CrossRef
  12. Ham WS, Kim WT, Lee JS, Ju HJ, Kang SJ, Oh JH, Her Y, Chung JY, Park K, and Choi YD. Efficacy and safety of red ginseng extract powder in patients with erectile dysfunction:multicenter, randomized, double-blind, placebo-controlled study. Korean Journal of Urology 2009;50:159-164.
    CrossRef
  13. Huang KC. The pharmacology of Chinese Herbs II. Boca Raton: CRC Press; 1999.
  14. Jeong S, and Yoon M. Fenofibrate inhibits adipocyte hypertrophy and insulin resistance by activating adipose PPARalpha in high fat diet-induced obese mice. Experimental and Molecular Medicine 2009;41:397-405.
    Pubmed KoreaMed CrossRef
  15. Jung DH, Lee YJ, Kim CB, Kim JY, Shin SH, and Park JK. Effects of ginseng on peripheral blood mitochondrial DNA copy number and hormones in men with metabolic syndrome:A randomized clinical and pilot study. Complementary Therapies in Medicine 2016;24:40-46.
    Pubmed CrossRef
  16. Jung S, Lee MS, Shin Y, Kim CT, Kim IH, and Kim Y. High hydrostatic pressure extract of red ginseng attenuates inflammation in rats with high fat diet-induced obesity. Preventive Nutrition and Food Science 2015;20:253-259.
    Pubmed KoreaMed CrossRef
  17. Karu N, Reifen R, and Kerem Z. Weight gain reduction in mice fed Panax ginseng saponin, a pancreatic lipase inhibitor. Journal of Agricultural and Food Chemistry 2007;55:2824-2828.
    Pubmed CrossRef
  18. Kelly DM, and Jones TH. Testosterone and obesity. Obesity Reviews 2015;16:581-606.
    Pubmed CrossRef
  19. Khera M, and Goldstein I. Erectile dysfunction. BMJ Clinical Evidence Array:1803.
  20. Kim JH, Hahm DH, Yang DC, Kim JH, Lee HJ, and Shim I. Effect of crude saponin of Korean red ginseng on high-fat diet-induced obesity in the rat. Journal of Pharmacological Sciences 2005;97:124-131.
    Pubmed CrossRef
  21. Lee H, Choi J, Shin SS, and Yoon M. Effects of Korean red ginseng (Panax ginseng) on obesity and adipose inflammation in ovariectomized mice. Journal of Ethnopharmacology 2016;178:229-237.
    Pubmed CrossRef
  22. Lee H, Kim M, Shin SS, and Yoon M. Ginseng treatment reverses obesity and related disorders by inhibiting angiogenesis in female db/db mice. Journal of Ethnopharmacology 2014;155:1342-1352.
    Pubmed CrossRef
  23. Lee H, Park D, and Yoon M. Korean red ginseng (Panax ginseng) prevents obesity by inhibiting angiogenesis in high fat dietinduced obese C57BL/6J mice. Food and Chemical Toxicology 2013;53:402-408.
    Pubmed CrossRef
  24. Lee HJ, Lee YH, Park SK, Kang ES, Kim HJ, Lee YC, Choi CS, Park SE, Ahn CW, Cha BS, Lee KW, Kim KS, Lim SK, and Lee HC. Korean red ginseng (Panax ginseng) improves insulin sensitivity and attenuates the development of diabetes in Otsuka Long-Evans Tokushima fatty rats. Metabolism 2009;58:1170-1177.
    Pubmed CrossRef
  25. Lee SH, Lee HJ, Lee YH, Lee BW, Cha BS, Kang ES, Ahn CW, Park JS, Kim HJ, Lee EY, and Lee HC. Korean red ginseng (Panax ginseng) improves insulin sensitivity in high fat fed Sprague-Dawley rats. Phytotherapy Research 2012;26:142-147.
    Pubmed CrossRef
  26. Lu JM, Yao Q, and Chen C. Ginseng compounds:an update on their molecular mechanisms and medical applications. Current Vascular Pharmacology 2009;7:293-302.
    Pubmed KoreaMed CrossRef
  27. McInnes KJ, Smith LB, Hunger NI, Saunders PT, Andrew R, and Walker BR. Deletion of the androgen receptor in adipose tissue in male mice elevates retinol binding protein 4 and reveals independent effects on visceral fat mass and on glucose homeostasis. Diabetes 2012;61:1072-1081.
    Pubmed KoreaMed CrossRef
  28. Michalakis K, Goulis DG, Vazaiou A, Mintziori G, Polymeris A, and Abrahamian-Michalakis A. Obesity in the ageing man. Metabolism 2013;62:1341-1349.
    Pubmed CrossRef
  29. Mollah ML, Kim GS, Moon HK, Chung SK, Cheon YP, Kim JK, and Kim KS. Antiobesity effects of wild ginseng (Panax ginseng C.A. Meyer) mediated by PPAR-gamma, GLUT4 and LPL in ob/ob mice. Phytotherapy Research 2009;23:220-225.
    Pubmed CrossRef
  30. Moyad MA, and Park K. What do most erectile dysfunction guidelines have in common? No evidence-based discussion or recommendation of heart-healthy lifestyle changes and/or Panax ginseng. Asian Journal Andrology 2012;14:830-841.
    Pubmed KoreaMed CrossRef
  31. Oh J, Lee H, Lim H, Woo S, Shin SS, and Yoon M. The herbal composition GGEx18 from Laminaria japonica, Rheum palmatum, and Ephedra sinica inhibits visceral obesity and insulin resistance by upregulating visceral adipose genes involved in fatty acid oxidation. Pharmaceutical Biology 2015;53:301-312.
    Pubmed CrossRef
  32. Oh J, Lee H, Park D, Ahn J, Shin SS, and Yoon M. Ginseng and Its Active Components Ginsenosides Inhibit Adipogenesis in 3T3-L1 Cells by Regulating MMP-2 and MMP-9. Evidence- Based Complementary and Alternative Medicine 2012:265023.
    CrossRef
  33. Okuno A, Tamemoto H, Tobe K, Ueki K, Mori Y, Iwamoto K, Umesono K, Akanuma Y, Fujiwara T, Horikoshi H, Yazaki Y, and Kadowaki T. Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats. The Journal of Clinical Investigation 1998;101:1354-1361.
    Pubmed KoreaMed CrossRef
  34. Park HJ, Kim DH, Park SJ, Kim JM, and Ryu JH. Ginseng in traditional herbal prescriptions. Journal of Ginseng Research 2012;36:225-241.
    Pubmed KoreaMed CrossRef
  35. Rana K, Fam BC, Clarke MV, Pang TP, Zajac JD, and MacLean HE. Increased adiposity in DNA binding-dependent androgen receptor knockout male mice associated with decreased voluntary activity and not insulin resistance. American Journal of Physiology. Endocrinology and Metababolism 2011;301:E767-E778.
    Pubmed CrossRef
  36. Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, and Mortensen RM. PAR款is required for the differentiation of adipose tissue in vivo and in vitro. Molecular Cell 1999;4:611-617.
    CrossRef
  37. Rosen ED, and Spiegelman BM. Molecular regulation of adipogenesis. Annual Review of Cell and Developmental Biology 2000;16:145-171.
    Pubmed CrossRef
  38. Semirale AA, Zhang XW, and Wiren KM. Body composition changes and inhibition of fat development in vivo implicates androgen in regulation of stem cell lineage allocation. Journal of Cellular Biochemistry 2011;112:1773-1786.
    Pubmed KoreaMed CrossRef
  39. Singh R, Artaza JN, Taylor WE, Braga M, Yuan X, Gonzalez- Cadavid NF, and Bhasin S. Testosterone inhibits adipogenic differentiation in 3T3-L1 cells:nuclear translocation of androgen receptor complex with beta-catenin and T-cell factor 4 may bypass canonical Wnt signaling to down-regulate adipogenic transcription factors. Endocrinology 2006;147:141-154.
    Pubmed KoreaMed CrossRef
  40. Siraj FM, Natarajan S, Huq MA, Kim YJ, and Yang DC. Structural investigation of ginsenoside Rf with PPAR款major transcriptional factor of adipogenesis and its impact on adipocyte. Journal of Ginseng Research 2015;39:141-147.
    Pubmed KoreaMed CrossRef
  41. Tambi MI, Imran MK, and Henkel RR. Standardised water-soluble extract of Eurycoma longifolia, Tongkat ali, as testosterone booster for managing men with late-onset hypogonadism?. Andrologia 2012;44:226-230.
    Pubmed CrossRef
  42. Traish AM. Testosterone and weight loss:the evidence. Current Opinion in Endocrinology, Diabetes and Obesity 2014;21:313-322.
    Pubmed KoreaMed CrossRef
  43. Varlamov O, White AE, Carroll JM, Bethea CL, Reddy A, Slayden O, O'Rourke RW, and Roberts CT. Androgen effects on adipose tissue architecture and function in nonhuman primates. Endocrinology 2012;153:3100-3110.
    Pubmed KoreaMed CrossRef
  44. Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, Sole J, Nichols A, Ross JS, Tartaglia LA, and Chen H. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. Journal of Clinical Investigation 2003;112:1821-1830.
    Pubmed KoreaMed CrossRef
  45. Yang JW, and Kim SS. Ginsenoside Rc promotes anti-adipogenic activity on 3T3-L1 adipocytes by down-regulating C/EBP慣and PPAR款. Molecules 2015;20:1293-1303.
    Pubmed CrossRef
  46. Yassin A, and Doros G. Testosterone therapy in hypogonadal men results in sustained and clinically meaningful weight loss. Clinical Obesity 2013;3:73-83.
    Pubmed KoreaMed CrossRef
  47. Yin J, Zhang H, and Ye J. Traditional Chinese medicine in treatment of metabolic syndrome. Endocrine, Metabolic & Immune Disorders Drug Targets 2008;8:99-111.
    Pubmed KoreaMed CrossRef
  48. Yun TK. Brief introduction of Panax ginseng C.A. Meyer. Journal of Korean Medical Science 2001;16:S3-S5.
    Pubmed KoreaMed CrossRef