AbstractGastric cancer is a malignant tumor of the stomach and has been the most common cancer in Korea for many years (Sasako, 2019). It is caused by repeated gastric mucosal damage due to stress, carcinogens or
We purchased cancer cell lines, AGS, TC-1, B16F10 and Ovcar3, from American Type culture collection (ATCC, Rockville, MD, USA).
Cancer cells were cultured in RPMI1640 (Welgene, Korea), Dulbeccós modified Eaglés medium (DMEM) containing 10% fetal bovine serum (Corning Cellgro, USA), 1% antibiotics (Invitrogen) and Trypsin EDTA (Sigma) and maintained at 37℃ in a humidified incubator with a 5% CO2 atmosphere. Cancer cells were seeded in 6-well plates and treated with GBE (0~100 μg/mL).
Cancer cells (AGS, TC-1, B16F10, and Ovcar3) were seeded in 96-well culture plates at a density of 3×103 cells/well. After 24 h, cancer cells were treated with GBE for 24 h. WST plus-8 cell proliferation assay reagent (GenDEPOT, TX, USA) was added to each well. Cell viability was determined using ELISA reader at 450 nm.
RNA was isolated using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions. Reverse transcription-polymerase chain reaction (RT-PCR) was performed using a reverse transcription system (TOYOBO, Tokyo, Japan) (primers listed in Table 1). PCR was performed using instructions in Ex-Taq (TaKaRa, Kyoto, Japan) manual. Real-time PCR was performed using SYBR Premix Ex Taq (Clontech Laboratories, Mountain View, CA, USA) with ABI instruments (Applied Biosystems Inc, Foster City, CA, USA). All results were normalized by β-actin.
Primer lists and sequence for RT-PCR
| Primer | Sequence (5' to 3') |
|---|---|
| β-actin | Forward: CCAGTTGGTAACAATGCCATGT |
| Reverse: GGCTGTATTCCCCTCCATCG | |
| TGFβ | Forward: CGTCAGCCGATTTGCTATCT |
| Reverse: CGGACTCCGCAAAGTCTAAG | |
| TNFα | Forward: ATGAAAGTCTCTGCCGCCCTCA |
| Reverse: TCCTTGGCAAAACTGCACCT | |
| p53 | Forward: GGCCCACTTCACCGTACTAA |
| Reverse: GTGGTTTCAAGGCCAGATGT | |
| Rb | Forward: TGTATCGGCTAGCCTATCTC |
| Reverse: AATTAACAAGGTGTGGTGG | |
| Bcl-2 | Forward: CATGTGTGTGGAGAGCGTCAAC |
| Reverse: CAGATAGGCACCCAGGGTGAT | |
| Bcl-xl | Forward: CGGTACCGGCGGGCATTCAG |
| Reverse: CGGCTCTCGGCTGCTGCATT | |
| Bax | Forward: TTTGCTTCAGGGTTTCATCCA |
| Reverse: CTCCATGTTACTGTCCAGTTCGT | |
| Bcl6 | Forward: CTGCAGATGGAGCATGTTGT |
| Reverse: TCTTCACGAGGAGGCTTGAT | |
| Sod2 | Forward: CTGAGGAGAGCAGCGGTCGT |
| Reverse: CTTGGCCAGCGCCTCGTGGT | |
| GADD45 | Forward: CGTTTTGCTGCGAGAACGAC |
| Reverse: GAACCCATTGATCCATGTAG | |
| CAT | Forward: GCGAATGGAGAGGCAGTGTAC |
| Reverse: GAGTGAGTTGTCTTCATTAGCACTG |
*Abbreviations: Beta-actin (β-actin), Transforming Growth Factor-β (TGF-β), Tumor Necrosis Factor (TNF-α), Tumor protein p53 (p53) Retinoblastoma protein (Rb), B-cell lymphoma 2 (Bcl-2), B-cell lymphoma-extra large (Bcl-xl), Bcl-2-associated X protein (Bax), B-cell lymphoma 6 (Bcl6), Superoxide Dismutase 2 (SOD2), Growth Arrest and DNA Damage-inducible 45 (GADD45), Catalase (CAT)
Cell lysate extractions were isolated with RIPA buffer (1% Triton X-100; 1% sodium deoxycholate; 0.1% sodium dodecyl sulfate; 150 mM NaCl; 50 mM Tris-HCl, pH 7.5; and 2 mM EDTA, pH 8.0). Cell lysates were incubated for 20 min on ice and centrifuged at 4℃ for 25 min at 13,200 rpm. Supernatant concentration was measured with protein assay reagent (Thermo Scientific, MA, USA). Protein samples were loaded into wells of the SDS-PAGE gel and transferred to PVDF or nitrocellulose membranes (Merck Millipore, MA, USA). The membranes were blocked with 5% skim milk or BSA for 1 h at room temperature. After blocking, membranes were incubated with primary antibodies overnight at 4℃. The membranes were washed 3 times for 10 min with PBST and incubated with HRP-conjugated secondary antibodies (Bethyl Laboratories, TX, USA) for 1 h at room temperature. The membranes were washed 3 times for 10 min with PBST. The FUSION SOLO S (Vilber, Eberhardzell, Germany) was used for image detection according to manufacturer's instructions. Antibodies used were anti-β-actin, anti-p53, anti-Rb, anti-Bcl2, anti-BclxL, and anti-Bax (Santa Cruz, TX, USA).
AGS cells were seeded in 6-well plates, allowed to incubate for 24 h and treated with 50 μg/mL GBE. A straight wound was created by scratching a confluent monolayer with a pipette tip. After scratching, AGS cells were washed by 1x PBS and maintained in serum-free RPMI1640 medium.
Statistical evaluations of the data were expressed as the mean ± SEM. Statistically significant differences between mean values for the treatment groups were analyzed by Student's
We investigated whether GBE regulates cell proliferation by treating various cancer cells (TC-1, AGS, OVCAR-3 and B16F10) with GBE in a dose-dependent manner (0~100 μg/mL). The degree of cell differentiation in AGS decreased following GBE 25 μg/mL treatment. B16F10 also showed a reducing tendency with increasing concentration, most significant (~50%) with 50 μg/mL treatment. As the concentration of GBE increased, AGS cell proliferation rate decreased (Fig. 1A). Cancer cell proliferation was observed by treatment with 50 μg/mL GBE in a time-dependent manner. Cell proliferation rate of AGS decreased in time-dependent manner. A reduction in cell differentiation was observed after 12 h of treatment; this phenomenon was not apparent in other cancer cells (Fig. 1B). These results indicate that GBE regulates the growth and differentiation of cancer cells. Based on the effects in AGS, a gastric cancer cell, it is evident that as GBE concentration increases, degree of cell differentiation and cell apoptosis decrease in a time-dependent manner.
Fig. 1. Since it was confirmed that GBE regulates the proliferation of cancer cells, the following experiment was conducted to determine the level of protein and RNA associated with cancer. Western blotting was used to confirm the levels of tumor suppressor markers p53 and Rb. Various cancer cells were treated with 50 μg/mL GBE, and after 24 h, cells were collected to identify proteins. p53 protein was expressed in all cancer cells, most common in AGS. Rb protein was weakly expressed in B16F10 and TC-1 and strongly in AGS (Fig. 2A), similar to RNA level (Fig. 2B). These results indicate that GBE affects cancer cell growth by regulating tumor suppressor protein and RNA levels.
Fig. 2. We treated several cancer cells with 50 μg/mL GBE to identify the expression of apoptosis-related genes and identified proteins and RNA after 24 h. Anti-apoptosis-related protein was expressed in various cancer cells. Protein expression of Bcl-2 and Bcl-xl was reduced in AGS in B16F10, OVCAR3, AGS, and TC-1. On the contrary, expression of Bax, a pro-apoptosis related protein, was increased in AGS cells (Fig. 3A). This was also the case at the RNA level (Fig. 3B). Based on these results, an experiment was conducted to confirm the change in expression of apoptosis-related proteins according to GBE concentration. Cells were treated with GBE (0~100 μg/mL) and western blotting was performed after 24 h. Expression of Bcl-2 and Bcl-xl decreased as GBE concentration increased, and Bax expression also increased (Fig. 3C). These results suggest that GBE affects cell growth and apoptosis by regulating apoptosis-related signaling within cells.
Fig. 3. Since we confirmed that GBE influenced the growth and differentiation of cancer cells by regulating tumor suppressor proteins, an experiment was conducted to determine whether cell motility was also affected. AGS was seeded in a 6-well plate and treated with 50 and 75 μg/mL GBE after 24 h, and a wound healing assay was performed. After 24 h, untreated cells had a narrowing clearance in half response. In addition, the scratch gap of GBE-treated cells was wider than that of untreated AGS cells. The same was true at 50 and 75 μg/mL (Fig. 4A, 4B). After 48 h, GBE-treated cells induced cell death. These findings confirmed that GBE inhibits cancer cell metastasis by reducing cell migration in gastric cancer cells.
Fig. 4. Since the anti-cancer effect of GBE was specifically exhibited in AGS cells, expression change of inflammation-related genes was examined. After GBE treatment (0~75 μg /mL), cells were collected and experiments were conducted by identifying RNA. When changes in expression of TGFβ and TNFα, well-known inflammatory genes, were observed, gene expression was confirmed to decrease as GBE concentration increased (Fig. 5A, 5B). It was verified that GBE had an anti-inflammatory effect, as expression of the GBE inflammatory gene decreased according to the concentration. In addition, to validate the anti-cancer effect, changes in p53 and Rb expression were investigated. As the concentration increased, the expression of p53 and Rb genes increased together, suggesting an anti-cancer effect of GBE on AGS cells (Fig. 5C, 5D). Therefore, experiments were conducted to determine the molecular mechanisms by which GBE had anti-cancer and anti-inflammatory effects on AGS through regulation. We demonstrated the change in expression of target genes of AKT signaling among several cell signaling pathways, known to have a negative effect on the growth and differentiation of cancer cells. Changes in expression of Bcl6, sod2, GADD45 and CAT were observed. Bcl6 and sod2 expression were found to decrease with increasing GBE concentration, and there was no change in expression of GADD45 and CAT (Fig. 5E, 5F, 5G, 5H). These results showed that GBE inhibits cancer cell growth and differentiation by regulating AKT signaling and has anti-cancer effects.
Fig. 5. Natural plant extracts have traditionally been used as medicinal ingredients for various diseases (Guerra et al., 2018).
Gastric cancer is caused by genetic and environmental factors and DNA damage. Chemotherapy or surgical treatment is used to induce cell death, but mortality is still rising (Chue et al., 2020; Lerner and Llor, 2020). Cancer cells are malignant cells characterized by infinite and invasive proliferation which infiltrates other organs. According to these characteristics, anti-cancer drugs are used to reduce proliferation rate and metastasis by inhibiting the cell cycle or inducing cell death (Sasako, 2019). Existing chemical-based anti-cancer drugs induce cancer cell death, but at the same time induce the death of normal and immune cells that perform defense functions (Lyons et al., 2017). Therefore, the effects of natural drugs that can improve treatment outcomes while weakening cell damage have recently been in the spotlight (Choi et al., 2018). Research is being actively conducted on plant extracts with anti-inflammatory and anti-cancer effects (Lafferty, 2018; Kim et al., 2020). Several studies have indicated that GBE, a natural plant extract, is effective in solid cancer; however, research on the specific mechanisms for regulating gastric cancer cell differentiation inhibition are insufficient.
This study was conducted to determine whether GBE is involved in differentiation and growth of cancer cells, to reduce side effects and induce effective inhibition of cancer cell proliferation. Among the various cancer cell types, AGS specifically exhibited the effect of GBE. It can be inferred that this effect is caused by gastric cancer cells with high specificity to the GBE component. We confirmed that GBE downregulates apoptosis of AGS, a gastric cancer cell line. Thus, we verified the expression of p53 and Rb tumor suppressor genes, and observed that their expression increased. In addition, the protein and gene expression of Bax, apoptosis marker, was elevated after GBE treatment. Conversely, the expression of anti-apoptosis markers Bcl-2 and Bcl-xl decreased. Therefore, GBE was confirmed to induce apoptosis in AGS. In addition, a wound healing assay was conducted to check whether the extract affected cancer cell migration. It was found that the scratch gap did not decrease compared to the control, which indicated that cell migration decreased after GBE treatment. In addition, we observed the mitogenic signaling pathway to control the anti-cancer effect of GBE. AKT signaling pathway is known to promote cell growth and differentiation as a phosphorylase (Roszak et al., 2017; Li et al., 2018). Excessive AKT activity induces infinite cell proliferation and division, leading to cancer; many studies have validated AKT as a cancer-related gene (Han et al., 2018). Expression of AKT target genes Bcl6, Sod2, CAT, and GADD45 were found to decrease. A molecular mechanism of the anti-cancer effects of GBE was thereby observed. However, there is a limitation in that the expression change of downstream AKT proteins was not confirmed. As a result, AKT was found to be the most controlled by GBE compared to other signaling pathways. In addition to AKT target genes, Mapk-related genes were discovered. Further experiments regarding Mapk-related protein expression levels should be conducted in future. Experiments on the downstream signaling mechanism of AKT related to GBE should also be progressed. Moreover, protein levels of cell signaling substances should be identified and additional apoptosis monitoring conducted through FACS analysis. Therefore, we would like to perform an
In conclusion, GBE downregulates cell proliferation and migration of AGS cells. We demonstrated that GBE inhibits cell growth associated with apoptosis-related genes and the AKT cell signaling pathway. Therefore, GBE can play an important role in regulating the canister progression of gastric cancer and we suggest GBE as a potential future therapeutic target.
This research was supported by a grant from Daegu Haany University Ky-lin Foundation in 2021.
No potential conflict of interest relevant to this article was reported.
