Search for


TEXT SIZE

search for



CrossRef (0)
The Effect of Scalp Acupuncture and rTMS on Neuromotor Function in Photothrombotic Stroke Rat Model
Biomed Sci Letters 2023;29:263-273
Published online December 31, 2023;  https://doi.org/10.15616/BSL.2023.29.4.263
© 2023 The Korean Society For Biomedical Laboratory Sciences.

Jong-Seong Park1,§,*, Eun-Jong Kim2,§,**, Min-Keun Song2,*, Jung-Kook Kim2,**, Ganbold Selenge2,** and Sam-Gyu Lee2,†,*

1Department of Physiology, Research Institute of Medical Sciences, Chonnam National University Medical School, Hwasun, Jeollanamdo 58128, Korea
2Department of Physical & Rehabilitation Medicine, Research Institute of Medical Sciences, Chonnam National University Medical School, Hwasun, Jeollanamdo 58128, Korea
Correspondence to: Sam-Gyu Lee. Department of Physical & Rehabilitation Medicine, Chonnam National University Medical School, Seoyang-ro 322, Hwasun-eup, Hwasun-gun, Jeollanam-do 58128, Korea.
Tel: +82-61-379-8280, Fax: +82-61-379-7779, e-mail: LEE9299@daum.net
*Professor, **Researcher.
§First authors, Jong-Seong Park and Eun-Jong Kim, are equally contributed in this study.
Received November 22, 2023; Revised November 29, 2023; Accepted December 1, 2023.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
 Abstract
This study aimed to investigate effect of scalp acupuncture (SA) and repetitive transcranial magnetic stimulation (rTMS) intervention on neuromotor function in photothrombotic cerebral infarction (PCI) rat model. Sixty male SD rats were used. PCI was induced on M1 cortex of right frontal lobe. SA was performed at the Qianding (GV21), Xuanli (GB6) acupoints of ipsilesional M1. Low-frequency rTMS was delivered to contralesional M1. All rats were randomly divided into 4 groups: group A, normal (n, 15); group B, PCI without any stimulation intervention (n, 15); group C, PCI with SA (n, 15); group D, PCI with rTMS (n, 15). Rota-rod test and Ladder rung walking test (LWT) were done weekly for 8 weeks after PCI. SA or rTMS was started from post-PCI 4th day as protocol for 8 weeks. H/E stain and IHC were done. Western blot and qRT-PCR study were performed for MAP2 and BDNF from ipsilesional M1 peri-infarction tissue. Brain MRI study was conducted to quantify the volume of cerebral infarction. As a result, left forelimb and hindlimb function significantly improved more in group C and D than control group, with expressed more BDNF and MAP2. And brain MRI showed focal infarction of right M1 after PCI, and infarction volume progressively decreased in group C and D than group B from post-PCI 5th to 8th week. SA or rTMS was more effective than no intervention group on neuromotor function of PCI rat model. The functional recovery was associated with stimulation intervention-related neurogenesis.
Keywords : Stroke, Acupunture, rTMS, Neurogenesis, Functional recovery
INTRODUCTION

Cerebral infarction is the most common form of stroke caused by the arteries that connect to brain becoming blocked or narrowed, resulting in ischemia, severely reduced blood flow (Lawrence et al., 1992).

In 1985, Watson et al. introduced photothrombosis as a technique to induce focal cerebral infarction in the cortical vasculature of rats (Watson et al., 1985). The key mechanism is a photochemical reaction triggered by systemic administration of Rose Bengal dye and focal illumination on the skull. Illumination leads to local activation of Rose Bengal dye, which results in free radical formation, endothelial dysfunction and local thrombosis in small cortical vessels (Schroeter et al., 2002; Braeuninger and Kleinschnitz, 2009). As compared to other animal models of stroke, animal preparation is relatively simple because it does not require mechanical manipulation of cerebral blood vessels or parenchyma (Yuan, 2009; Antje, 2012). Better understanding animal models has been used to understand the pathophysiology of stroke and to guide the development of more effectively therapeutic or rehabilitative interventions.

The repetitive transcranial magnetic stimulation (rTMS) commonly used as a treatment of many neurological disorders creating magnetic field pulses, which in turn can induce electrical activity in focal brain areas. The rTMS is a novel neuro-stimulation method capable of inhibiting neuronal activity when given in low frequency. It is the fact that the major advantage of rTMS is capable of investigating the cellular and molecular mechanisms in their appropriate animal models or in vitro preparations, which various forms of plasticity have been studied in great detail using these models during the past several decades (Kobayashi and Pascual, 2003; Florian and Andreas, 2013).

Scalp acupuncture (SA) has long been used in Korea as well as China including other oriental countries for stroke, and has been proposed as a complementary therapy in stroke rehabilitation even in Western medicine since 1998 (WHO Task Force, 1989; Hui et al., 2000). However, to date, no convincing scientific evidence from clinical trials has been published showing acupuncture to be effective as an adjuvant therapy for enhancing functional restoration in stroke (Sze et al., 2002; Wu et al., 2006). Acupuncture involves the stimulation of anatomical locations on the skin by a variety of technique. The commonest technique used to penetrate the skin by thin, solid, metallic needles (NIH Consensus Conference, 1998). Acupuncture may alter pain threshold via release of neurotransmitters and neuropeptides (Kim et al., 2008). Acupuncture may also induce the change in regional blood flow surrounding cerebral infarct (Lee et al., 2003).

The overall objective of this study was to investigate the effect of SA or rTMS in photothrombotic stroke rat model with neurobehavioral, histopathological evaluation, and brain MRI study (Paul and Joseph, 2001; Byun and Kwak, 2013).

MATERIALS AND METHODS

Experimental animals

Sixty male Sprague-Dawley rats (Samtako, Osan, Korea) of 8-week-old, weighing 200~250 grams, were housed in group of 20 cages at a temperature of 23.0짹1.0꼦 and humidity of 50.0짹5.0% with a 12 h/12 h light-dark cycle (light on at 7:00 h) and had free access to food and water ad libitum. Food and water supplied available ad lib. during experimental period. All animal experiment protocols were carried out in accordance with the guidelines of the Chonnam National University Animal Care and Committee (IRB No. CNU IACUC H 2014 33).

Photothrombotic stroke rat model

Photothrombotic cerebral infarction was induced based on the methods described by Watson and colleagues (Watson et al., 1985). Briefly, each rat was anesthetized with 5% forane and maintained with 2% isoflurane in a mixture of 70% nitrous oxide and 30% oxygen during the surgical procedure. The operation was performed on a homeothermic plate (Harvard Apparatus, South Natick, USA) to maintain body temperature at 37.0짹0.5꼦. The rat was prone-placed on stereotactic frame (Stoelting, Wood Dale, USA) with the skull bone fixed, and with a 6 mm aperture opened at the scalp over the right frontal cortex, 1 mm anterior and 3 mm lateral to the bregma. After incision and exposure of the scalp, Rose Bengal dye (Sigma-Aldrich Co, St. Louis, USA) of 50 mg/kg was administered into the left femoral vein with Rose Bengal solution of 20 mg/mL, and light exposure with KL 1500 LCD (SCHOTT, Hattenbergstrasse, Germany) was given onto the cortical area of the aperture corresponding to the forelimb area of the primary motor cortex with 3,300 K and 150 W through the light source probe of 3.5짹0.5 mm in diameter. The illumination through the skull for 20 minutes was performed on 3 minutes after administration of Rose Bengal dye through the catheter of left femoral vein. The scalp was sutured with 4-0 black silk and rats were allowed to wake up from the anesthesia.

Stimulation intervention

A disposable acupuncture needles (0.25 횞 15 mm, Dongbang, Boryeong, Korea) were used for the scalp acupuncture. Acupuncture stimulation was performed from post-PCI 4th day with a schedule of 10 minutes a day, five days a week, a total of 8 weeks. The start point Qianding (GV21) of acupunture was on the sagittal suture 2 mm in front of lambda and the endpoint Xuanli (GB6) located in middle of superior orbit over right coronal suture (WHO Scientific Group, 1991) (Fig. 1).

Fig. 1. Scalp acupuncture points. The start point Qianding (GV21) of acupunture was on the sagittal suture 2 mm in front of lambda and the endpoint Xuanli (GB6) located in middle of superior orbit over right coronal suture (A). Red line depicts a rectangular line to the Sagittal suture 2 mm in front of lambda (B). A disposable acupuncture needles (0.25 횞 15 mm, Dongbang, Boryeong, Korea) were used for the scalp acupuncture from post-PCI 4th day (C).

Repetitive transcranial magnetic stimulation (rTMS): The low-frequency rTMS (MagStim, Whitland, Dyfed, UK) of 0.5 Hz was performed on the contralesional corresponding cortex, delivered as a schedule of 300 pulses/session/day, 5 days per week for 8 weeks, with a figure of 8 coil (inner diameter, 2.5 cm; outer diameter, 5 cm) at the intensity of 80% of the motor threshold from post-PCI 4th day (Fernanda et al., 2008; Gillick and Zirpel, 2012).

Neurobehavioral study

All experimental rats were regularly trained for 5 minutes/set, 5 sets/session, one session day after day with Rota-rod test from post-PCI 4th day (Jung et al., 2013).

Ladder rung walking test: The horizontal ladder rung walking test apparatus consisted of side walls made of clear Plexiglas and metal rungs (3 mm in diameter), which could be inserted to create a floor with a minimum distance of 1 cm between rungs (Metz and Whishaw, 2002). The side walls were 1 m long and 19 cm high measured from the height of the rungs. The ladder was elevated 30 cm above the ground with a neutral start cage and a refuge home cage at the end (Gerlinde and Ian, 2009). The difficulty of the task was modified by varying the position of the metal rungs. A regular pattern of the rungs allowed the animals to learn the pattern over several training sessions and to anticipate the position of the rungs. An irregular pattern that was changed from trial to trial prevented the animal from learning the pattern. The qualitative evaluation of forelimb and hindlimb placement was performed using a novel foot fault scoring system. The types of forelimb and hindlimb placement on the rungs were rated using a 7-category scale. The foot placement on the rung was rated according to its position and errors that occurred in placement accuracy (Tomoko and John, 2013). The scores of five steps were averaged and used for analysis.

Immunohistochemical study

The expression of Microtubule-associated protein 2 (MAP2) and BDNF (H-117 sc-20981, Santa Cruz Biotechnology, Inc., USA) was determined by immunohistochemical method. Paraffin sections were deparaffinized in xylene, hydrated and then placed in TBS (Life Science division, Inc., USA)-Twin 20. The sections were then incubated in 0.3% H2O2 for 30 min to inactivate endogenous peroxydase and immersed in 0.05 M Tris/HCL for 5 min, 3 times. Subsequently, sections were incubated first with 3% donkey serum (Sigma-Aldrich, USA) to decrease non-specific staining and then reacted with the primary antibody: anti-MAP2 (Sigma-Aldrich, USA) at a 1:200 dilution in TBS-T, and anti-BDNF at a 1:500 dilution in TBS-T. The sections were then incubated overnight in a moist chamber at 4.0꼦. On the next day, the sections were washed with TBS-T for 10 minutes, 3 times. Afterwards, they were treated with the secondary biotinylated rabbit-anti-mouse IgG antibody 1 hour at room temperature (1:500, Chemicon, USA). The sections were visualized with 3,3'-diaminobenzidine (DAB) substrate for 1 to 3 min and counterstained with hematoxylin.

Western blot analysis

The peri-infarcted M1 tissue of rat was homogenized with 500 關L of lysis buffer. The tissue was immediately put on ice and 13,000 rpm for 30 min at 4.0꼦, the supernatant was collected for protein analysis. For detection of MAP2 protein, equal amounts of volume (20 關g) were separated in 10% SDS-polyacrylamide gel. For detection of BDNF protein, equal amounts of volume (20 關g) were separated in 12% SDS-polyacrylamide gel. The gel was electrotransferred to a polyvinylidene difluoride membrane at 300 mA for 1 hour. Membranes were stained with Ponceau Red to ensure equal protein loading. Immunodetection of the protein of interest was carried out by first blocking the membrane in 5% skim milk for 1 hour at room temperature. Then the membranes were washed with TBS-T for 3 min, 3 times. After that, the membranes were incubated overnight in TBS-T with each primary antibody of anti-MAP2 and anti-BDNF at 4.0꼦.

Excess antibody was removed by TBS-T for 5 min, 3 times. The membranes were incubated with secondary antibody, a HRP-conjugated goat anti-rabbit IgG (1:1,000 dilution, Upstate Biotechnology, USA) in TBS-T for 1 hour. The membranes were washed again with TBS-T for 5 min, 3 times and immunoreactive protein bands were visualized using the Enhanced Chemiluminescence Plus (ECL Plus, Amersham, UK) and Image Reader (LAS-300 Imaging System, Fuji Photo FilmTM, Japan).

Quantitative real time-PCR

Specimens are attained from peri-infarcted M1 tissue of rat for gene analysis with RT-PCR. Total RNA was extracted with TRIzol Reagent (Life TechnologiesTM, Carlsbad, USA) and GoScriptTM Reverse Transcriptase (Promega, Medison, USA) was used for cDNA synthesis. Quantitative RT-PCR detection was performed using Real-Time PCR Systems (ABI7500, Life TechnologiesTM, Carlsbad, USA) and a fluorescent probe in CYBR Green (Life TechnologiesTM, Carlsbad, USA). GAPDH was used for RNA level normalization. Primers are as follows (Gene: forward primer, reverse primer, bp of product size); MAP-2: GTCCATTAACTTGCCTATGTCT, CCGCTAGTGTTGGTTAGAATA, 111, BDNF: CCATAAGGACGCGGACTTGTA, CATAGACATGTTTGCGGCATC, 124, GAPDH: GGGCATCCTGGGCTACACTGA, CCTTGCTGGGCTGGGTGGT, 207.

Brain magnetic resonance imaging (MRI) study

MR imaging study was conducted on post-PCI 4th day, 5th and 8th week with the SignaTM Excite HD 1.5T Magnetic Resonance System for rat brain imaging (GE Medical Systems, USA). Experimental rats were anesthetized by administration of Zoletil of 100 mg/kg into abdominal cavity before 10 minutes of imaging. MR imaging was taken as T1-weighted spin echo (T1W SE), and T2-weighted turbo-spin echo (T2W TSE) to verify the focal infarction and to quantify the infarction volume in photothrombotic stroke rat model. T1W SE MRI (T1WI, TR/TE=500/15 ms) was acquired with a field of view (FOV) of 25 횞 25 and an imaging matrix of 320 횞 192, resulting in an acquisition time of 4 min and 31 sec. T2W TSE (T2WI, TR/TE=5517/105 ms) was acquired with a FOV of 25 횞 25 and an imaging matrix of 384 횞 288, resulting in an acquisition time of 4 min and 31 sec. T1 Sagittal is a TR/TE=253/13 ms, FOV 25 횞 25, slice thickness 1.9 횞 1.0 mm, matrix 320 횞 224, scan time 3 min and 48 sec. T2 Coronal is a TR/TE= 4150/104 ms, FOV 25 횞 25, 1.9 횞 1.0 mm slice thickness, matrix 384 횞 320, scan time 3 min and 24 sec.

Statistical analysis

Statistical analysis was performed using SPSS for Windows (ver. 21.0; SPSS Inc., Chicago, IL, USA). Data are presented as mean 짹 SD. ANOVA test was used to determine statistical significance among groups. A probability level of P<0.05 was considered to be statistically significant.

RESULTS

During experiment, three rats died (2 rats on post-PCI 8th week in group B, 1 rat of post-PCI 4th week in group C), which cause may be physical or environmental stress associated with individual variation.

Neurobehavioral study

The movements of release, collection and manipulation associated with walking on the ladder revealed that left forelimb function significantly more improved in group C and D than group B from post-PCI 4th week, and left hindlimb at 8th week on Ladder rung walking test (P<0.05). Most categories did not differ between lesion and normal rats, except that correct placement of the contralateral forelimb occurred more frequently in the normal rats than in lesion rats (Fig. 2).

Fig. 2. Ladder rung walking test: Ladder rung walking test showed that left fore- and hindlimb function significantly improved in group C and D compared to group A from post-PCI 4th week. Group A, normal; Group B, PCI without any stimulation intervention; Group C, PCI with SA; Group D, PCI with rTMS. PCI, photothrombotic cerebral infarction; SA, scalp acupuncture; rTMS, repetitive transcranial magnetic stimulation.

Histopathological study

H&E of ipsilesional M1 showed that the cellularity was more dense and eosinophilic cells were decreased more in group C (43.3% decrease) and group D (54.5% decrease) than group B in eosinophilic cell count by Image J 1.44p (Wayne Rasband, NIH, USA) (Fig. 3). Immunohistochemical study expressed more BDNF (Fig. 4) and MAP2 (Fig. 5) in group C and D than group B on post-PCI 5th week, but no expressional differenced on post-PCI 8th week.

Fig. 3. Histopathological study. H&E stain of ipsilesional M1 showed that the cellularity was more dense and eosinophilic cells were decreased more in group C and D than group B. Group A, normal; Group B, PCI without any stimulation intervention; Group C, PCI with SA; Group D, PCI with rTMS. PCI, photothrombotic cerebral infarction; SA, scalp acupuncture; rTMS, repetitive transcranial magnetic stimulation (H&E 200횞, 400횞; scale bar 50 關m, 25 關m).

Fig. 4. Immunohistochemical study for BDNF on post-PCI 5th week. Immunohistochemical study expressed more BDNF in group C and D than group B on post-PCI 5th week, but no expressional differences on post-PCI 8th week. Group A, normal; Group B, PCI without any stimulation intervention; Group C, PCI with SA; Group D, PCI with rTMS. PCI, photothrombotic cerebral infarction; SA, scalp acupuncture; rTMS, repetitive transcranial magnetic stimulation (blue arrow, BDNF; IHC 200횞, 400횞; scale bar 50 關m, 25 關m).

Fig. 5. Immunohistochemical study for MAP2 on post-PCI 5th week. Immunohistochemical study expressed more MAP2 in group C and D than group B on post-PCI 5th week, but no expressional differences on post-PCI 8th week. Group A, normal; Group B, PCI without any stimulation intervention; Group C, PCI with SA; Group D, PCI with rTMS. PCI, photothrombotic cerebral infarction; SA, scalp acupuncture; rTMS, repetitive transcranial magnetic stimulation (orange arrow, MAP2; IHC 200횞, 400횞; scale bar 50 關m, 25 關m).

Western blot analysis

Western blot study revealed that significantly, BDNF was more increased in group C and D than group B on post-PCI 2nd week, more increased in group C than group B on post-PCI 5th week, and MAP2 more increased in group C and D than group B on post-PCI 5th week (P<0.05) (Fig. 6). No expressional differences were seen in BDNF and MAP2 among all groups on post-PCI 8th week along spontaneously biological degradation process.

Fig. 6. Western blot study for BDNF and MAP2. Western blot study revealed that BDNF was more increased in group C and D than group B on post-PCI 2nd week, more increased in group C than group B on post-PCI 5th week, and MAP2 was more increased in group C and D than group B on post-PCI 2nd week, and more increased in group C than group B on post-PCI 5th week. No expressional differences were seen in BDNF and MAP2 among all groups on post-PCI 8th week. Group A, normal; Group B, PCI without any stimulation intervention; Group C, PCI with SA; Group D, PCI with rTMS. PCI, photothrombotic cerebral infarction; SA, scalp acupuncture; rTMS, repetitive transcranial magnetic stimulation.

Quantitative RT-PCR

Quantitative RT-PCR revealed that significantly, gene expression for BDNF increased more in group C and D than group B, and that of MAP2 more in group C than group B on post-PCI 2nd week, and showed more increased expression state of both still on post-PCI 3 weeks (P<0.05) (Fig. 7).

Fig. 7. Quantitative RT-PCR study for BDNF and MAP2. Quantitative RT-PCR revealed that gene expression for BDNF increased in group C and D than group B on post-PCI 2nd week, and that of MAP2 in group C than group B, and showed more increased expression state still on post-PCI 3rd week. Group A, normal; Group B, PCI without any stimulation intervention; Group C, PCI with SA; Group D, PCI with rTMS. PCI, photothrombotic cerebral infarction; SA, scalp acupuncture; rTMS, repetitive transcranial magnetic stimulation.

Brain MRI study

Brain MRI showed the focal infarction of right M1 after PCI, and the volume of infarction significantly decreased in group C (142.2 mm3 to 110.2 mm3; 22.5% decrease) and group D (161.9 mm3 to 117.3 mm3; 27.5% decrease), than group B (148.2 mm3 to 136.8 mm3; 7.7% decrease) from post-PCI 5th week to 8th week (P<0.05) (Fig. 8).

Fig. 8. Brain MRI study of experimental rats. Brain MRI showed the focal infarction of right M1 after PCI on coronal T1- and T2weighted imaging, and the infarction volume significantly decreased from post-PCI 5th week to 8th week in group C (142.2 mm3 to 110.2 mm3; 22.5%) and D (161.9 mm3 to 117.3 mm3; 27.5% decrease), than group B (148.2 mm3 to 136.8 mm3; 7.7% decrease) as times going on. Group A, normal; Group B, PCI without any stimulation intervention; Group C, PCI with SA; Group D, PCI with rTMS. PCI, photothrombotic cerebral infarction; SA, scalp acupuncture; rTMS, repetitive transcranial magnetic stimulation.
DISCUSSION

Stroke is one of the leading causes of death and adult disability in the world, underdeveloped and developed country. Stroke caused frequently inevitable, devastating and irreversible loss of function, further resulted in loss of activities of daily living (ADL) performance. The problems from stroke include a wide range of cognitive and sensorimotor deficits representing partial to complete paralysis as well as muscle tone and coordination disorder.

The photothrombotic stroke rat is the well-known model for studying focal cerebral infarction as an animal experiment. The photothrombotic lesion can be customized in order to affect a precise function according to the targeted area and neurobehavioral recuperation can be assessed by various tests (Baskin et al., 2003; Lee et al., 2007). And a lot of trail to find the mechanism and material has been attempted to improve the neuromotor function of photothrombotic stroke.

Scalp acupuncture may stimulate focal cerebral area as one of the stimulation interventions in modern medicine as well as ancient medicine.

Recent studies have demonstrated the beneficial effect of scalp acupuncture in treatment of ischemic stroke (Yan et al., 2012). Acupuncture may stimulate nerve fibers in the skin and muscles, triggering action potentials and the release of substances that can dilate vessels (increasing local blood flow). This may help to encourage tissue healing (Wang et al., 2010).

SA and/or rTMS may provide the favorable effect on neurologic impairment, However, the precise mechanism is not well known still now, and need to be further explored. Importantly, SA and rTMS can also examine the effects of its application to other regions involved in motor control processes. This suggests that any stimulation intervention will do affect neural activities, possibly through stimulation-induced cellular mechanism to modulate neuromotor function in neurorehabilitation.

The present experiment demonstrates also that some proteins involved in neuronal structure and function are dynamically altered during the course of motor learning, as a predictable pattern of expression (Derksen et al., 2007).

The rTMS is one of the typical stimulation interventions for focal cerebral area in past decades. Previous studies reported that the suppression of excitability of contralesional corresponding motor cortex can enhance motor performance of the ipsilesional hand motor cortex in rat, presumably through the suppression of inhibition and hence release of excitability of the ipsilesional motor cortex. In rats, acute cortical lesions lead to an increase in excitability of motor areas of the contralateral hemisphere and facilitation of motor learning skill in the unaffected forelimb. This study demonstrated that low-frequency rTMS on contralesional M1 can lead to neurobehavioral gain for the performance of a simple motor task with the affected hand, without obvious adverse effects (Strens et al., 2003).

The rTMS induces long-term potentiation (LTP) or depression (LTD), which in turn, produce lasting changes on neocortical excitability and synaptic connections. Experimental evidences suggest that rTMS induces changes in neurotransmitter release, trans-synaptic efficiency, signaling pathways and gene transcription. Furthermore, recent studies suggest that rTMS induces neurogenesis, neuronal viability and secretion of neuroprotective molecules in an animal model (Oscar, 2008).

After cerebral infarction, the functional recovery depends on neural recovery including cognitive, neuromotor and behavioral improvement in the background of neurogenesis.

Neuroplasticity is a term which in part describes the brain's ability to rewire itself in response to environmental stimulus. Brain plasticity means brain's ability to reorganize itself by forming new neural connections throughout the life. Neuroplasticity allows the neurons in the brain to compensate for injury and disease and to adjust their activities in response to new situations or to changes in their environment.

Reorganization takes place by mechanisms called axonal sprouting in which undamaged axons grow new nerve endings to reconnect neurons whose links were injured or severed. Animal studies suggest that BDNF is a key mediator in synaptic efficacy, neuronal connectivity and use-dependent plasticity (Nudo et al., 1996; Bagnard et al., 1998).

This study deals with the functional neuromotor, histopathological and brain MR imaging study in photothrombotic stroke rat model for 8 weeks follow-up period. This is a relatively long-term follow-up study dealing with neurofunctional changes, different from other previous studies, almost all of which are restricted in about 4 weeks follow-up of structure-functional relationship in stroke rat model (Whishaw, 2000).

The present study introduced the ladder rung walking task as a functional evaluation test to assess skilled walking, limb placement and limb coordination. Although reports were suggested that the strength of the ladder rung walking test is that it is sufficiently challenging to reveal subtle chronic impairments in both fore- and hind-limb use and unmask impairments that require forebrain control, the essential function required to accomplish successfully the ladder rung walking test is fine-adjusted muscle and limb coordination, and the ability to perform balanced weight supported stepping movements (Metz and Whishaw, 2002).

Generally, it is well known that BDNF or MAP2 represents as one of the marker of the neurogenesis. The results of this study showed that the level of two structural proteins for neurogenesis, BDNF and MAPS, are elevated in the border zone of infarction rat brain with stimulation intervention from post-PCI 2nd to 5th week.

However, the level of MAP2 mRNA did not precisely parallel the increase in protein immunoreactivity, that is, in the older rats, the MAP2 mRNA around the lesion site was much lower than expected based on the amount of MAP2 immunoreactivity in the same region. It assumed to be in limitation of experimental circumstances or somewhat variability of gene-protein relationship.

BDNF mRNA expression was measured also in the infarct border zone of rat brain, for the evaluation of contribution into the induction of neurogenesis measured by synaptophysin expression (Judith, 2004; Feng et al., 1994).

Rat brain MRI of this study revealed the focal infarction of right M1 after PCI, and the infarction volume progressively decreased in group C (22.5%) and D (27.5%) than group B (7.7%) as times going on.

These results may suggest that the goal-directed stimulation intervention combined with conventional exercise program is more effective than conventional exercise program only. Each stimulation intervention will do for the decrease of infarction area and volume, especially in group D, rTMS-intervention PCI group.

Several limitations reside in this study. First, stimulation was delivered during anesthetic condition, and so the resultant effect may be possible to be affected by anesthetics. Second, the issued problem is which the rTMS parameter compared to SA except duration is adequate or not, even though stimulation parameter was adopted as suggested in other previous study. And third, as for neurobehavioral study, the regular evaluation trials inevitably may cause accommodation-related bias and furthermore stressful condition in some experiment rats in this relatively long-term follow-up experiment study. Generally, the neurofunctional animal study should be explored for the long-term follow-up over 6 weeks as in CNS-lesion rat model, but the gene-protein relationship of interest may not be prolonged over about 5 weeks after lesion modelling, which limitation may play a hindrance not to elucidate the precise mechanism for structure-functional changes. Even though this study also did not fully overcome these limitations, considering the results, it suggests a meaningful implication for the favorable structure-functional changes in PCI rats with goal-directed stimulation intervention and conventional exercise program more than conventional exercise program only.

In conclusion, the SA or rTMS as one of the stimulation interventions was individually more effective than no intervention group on neuromotor function of PCI rat model. The functional recovery was associated with stimulation intervention-related neurogenesis. Further research may be needed for the precise mechanism and effectiveness of individual stimulation intervention for neurogenesis in stroke.

ACKNOWLEDGEMENT

"This research was supported by Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Education, Science and Technology (NRF-2017R1D1A1A02019434)".

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

References
  1. Antje S, Maike H, Jan KS. Photochemically induced ischemic stroke in rats. Experimental & Translational Stroke Medicine. 2012. 4: 13.
    Pubmed KoreaMed CrossRef
  2. Bagnard D, Lohrum M, Uziel D, Puschel AW, Bolz J. Semaphorins act as attractive and repulsive guidance signals during the development of cortical projections. Development. 1998. 125: 5043-5053.
    Pubmed CrossRef
  3. Baskin YK, Dietrich WD, Green EJ. Two effective behavioral tasks for evaluating sensorimotor dysfunction following traumatic brain injury in mice. J. Neurosci Methods. 2003. 129: 87-93.
    Pubmed CrossRef
  4. Braeuninger S, Kleinschnitz C. Rodent models of focal cerebral ischemia: procedural pitfalls and translational problems. Exp Transl Stroke Med. 2009. 1: 8.
    Pubmed KoreaMed CrossRef
  5. Byun JS, Kwak BK. Engraftment of Human Mesenchymal Stem Cells in a Rat Photothrombotic Cerebral Infarction Model: Comparison of Intra-Arterial and Intravenous Infusion Using MRI and Histological Analysis. J Korean Neurosurg Soc. 2013. 54: 467-476.
    Pubmed KoreaMed CrossRef
  6. Derksen MJ, Ward NL, Hartle KD, Ivanco TL. MAP2 and synaptophysim protein expression following motor learning suggests dynamic regulation and distinct alterations coinciding with synaptogenesis. Neurobiol Learn Mem. 2007. 87: 404-415.
    Pubmed CrossRef
  7. Feng YL, Lu D, Edward G. Jones Thoenen. Activity-dependent and hormonal regulation of neurotrophin mRNA levels in the brain-implications for neuronal plasticity. J Neurobiol. 1994. 25: 1362-1372.
    Pubmed CrossRef
  8. Fernanda W, Pedro B, Jairo BF, Carlos EU, Valdir FP, Joaquim PB. Low frequency (0.5 Hz) rTMS over the right (non-dominant) motor cortex does not affect ipsilateral hand performance in healthy humans. Arq Neuropsiquiatr. 2008. 66: 636-640.
    Pubmed CrossRef
  9. Florian MD, Andreas V. Unraveling the cellular and molecular mechanisms of repetitive magnetic stimulation. Front Mol Neurosci. 2013. 6: 50.
    Pubmed KoreaMed CrossRef
  10. Gerlinde AM, Ian QW. The Ladder Rung Walking Task: A Scoring System and its Practical Application. J Vis Exp. 2009. 28: 1204.
    CrossRef
  11. Gillick BT, Zirpel L. Neuroplasticity: an appreciation from synapse to system. Arch Phys Med Rehabil. 2012. 93: 1846-1855.
    Pubmed CrossRef
  12. Hui KK, Liu J, Makris N, et al. Acupuncture modulates the limbic system and subcortical gray structures of the human brain evidence from fMRI studies in normal subjects. Hum Brain Map. 2000. 9: 13-25.
    CrossRef
  13. Judith DS. Motor rehabilitation and brain plasticity after hemiparetic stroke. Progress in Neurobiology. 2004. 73: 61-72.
    Pubmed CrossRef
  14. Jung JS, Kwak BK, Alavala MR, Ha BC, Shim HJ, Byun JS, Kang SH, Park ES. Characterization of Photothrombotic Cerebral Infarction Model at Sensorimotor Area of Functional Map in Rat. 2013. 30: 617-628.
  15. Kim YS, Hon JW, Na BJ, et al. The effect of low vs high frequency electrical acuoint stimulation on motor recovery after ischemic stroke by motor evoked potentials study. Am J Chin Med. 2008. 36: 45-54.
    Pubmed CrossRef
  16. Kobayashi M, Pascual L. Transcranial magnetic stimulation in neurology. Lancet Neurol. 2003. 2: 145-156.
    Pubmed CrossRef
  17. Lawrence M; Brass. Stroke. Ch18. 1st ed. YUS of Med Heart. 1992, p215-233.
  18. Lee JD, Chon JS, Jeong HK, et al. The cerebrovascular response to traditional acupuncture after stroke. Neuroradiology. 2003. 45: 780-784.
    Pubmed CrossRef
  19. Lee JK, Park MS, Kim YS. Photochemically induced cerebral ischemia in a mouse model. Surg Neurol. 2007. 67: 620-625.
    Pubmed CrossRef
  20. Lee MC, Jin CY, Kim HS, Kim JH. Stem Cell Dynamics in an Experimental Model of Stroke. Chonnam Med J. 2011. 47: 90-98.
    Pubmed KoreaMed CrossRef
  21. Metz GA, Whishaw IQ. Cortical and subcortical lesions impair skilled walking in the ladder rung walking test: a new task to evaluate fore- and hindlimb stepping, placing, and co-ordination. Journal of Neuroscience Methods. 2002. 115: 169-179.
    Pubmed CrossRef
  22. NIH Consensus Conference. Acupuncture. JAMA. 1998. 280: 1518-1524.
    CrossRef
  23. Nudo RJ, Wise BM, SiFuentes F, Milliken GW. Neural substrates for the effects of rehabilitative training on motor recovery after ischemic infarct. Science. 1996. 272: 1791-1794.
    Pubmed CrossRef
  24. Oscar AC. Basic Mechanisms of rTMS: Implications in Parkinson's disease. Int Arch Med. 2008. 1: 2.
    Pubmed KoreaMed CrossRef
  25. Paul HP, Joseph WE. A photothrombotic model of small early ischemic infarcts in the rat brain with histologic and MRI correlation. J Pharma and Toxi Methods. 2001. 45: 227-233.
    Pubmed CrossRef
  26. Schroeter M, Jander S, Stoll G. Non-invasive induction of focal cerebral ischemia in mice by photothrombosis of cortical microvessels: characterization of inflammatory responses. J Neurosci Methods. 2002. 117: 43-49.
    Pubmed CrossRef
  27. Strens LH, Fogelson N, Shanahan P, Rothwell JC, Brown P. The ipsilateral human motor cortex can functionally compensate for acute contralateral motor cortex dysfunction. Current Biology. 2003. 13: 1201-1205.
    Pubmed CrossRef
  28. Sze FK, Wong E, Or KK, Lau J, Woo J. Does acupuncture improve motor recovery after stroke? A meta-analysis of randomized controlled trials. Stroke. 2002. 33: 2604-2619.
    Pubmed CrossRef
  29. Tomoko K, John WK. Motor learning principles for neurorehabilitation. Handbook of Clinical Neurology. 2013. Vol. 110 (3rd series).
    CrossRef
  30. Wang GJ, et al. Meridian studies in China: A Systematic Review. J Acupunc Meridian Stud. 2010. 3: 1-9.
    Pubmed CrossRef
  31. Watson BD, Dietrich WD, Busto R, Wachtel MS, Ginsberg MD. Induction of reproducible brain infarction by photochemically initiated thrombosis. ANN Neurol. 1985. 17: 497-504.
    Pubmed CrossRef
  32. Whishaw IQ. Loss of the innate cortical engram for action patterns used in skilled reaching and the development of behavioral compensation following motor cortex lesions in the rat. Neuropharmacology. 2000. 39: 788-805.
    Pubmed CrossRef
  33. WHO Scientific Group. A Proposed Standard International Acupuncture Nomenclature: Report of a WHO Scientific Group World Health Organization Geneva. 1991, p36.
  34. WHO Task Force. Recommendations on stroke prevention, diagnosis, and therapy. Report of the WHO Task Force on Stroke and other Cerebrovascular Disorders. Stroke. 1989. 20: 1407-1431.
    Pubmed CrossRef
  35. Wu HM, Tang JL, Lin XP, et al. Acupuncture for stroke rehabilitation. Cochrane Database Syst Rev. 2006. 3: CD004131.
    CrossRef
  36. Yan W, Jian GS, Xiu MW. Scalp Acupuncture for Acute Ischemic Stroke: A Meta-analysis of Randomized Controlled Trials. Evi-Based Comp and Alt Med. 2012: 9.
    CrossRef
  37. Yuan J. Neuroprotective strategies targeting apoptotic and necrotic cell death for stroke. Apoptosis. 2009. 14: 469-477.
    Pubmed KoreaMed CrossRef